Alright, the plan is that this will be updated every two weeks, but with any luck it'll be more often than that. And if not, you all have permission to grab a baseball bat and go to town on me. But don't hit too hard, though, 'cuz I still have to be able to type out chapters.
Okay? Okay.
This is the most coherent dream I've ever had in novel form with tons more additions and modifications. This will center around OCs, but be glad they're legitimate characters and not a blatant author insert. Canon characters will show up a few times but other than that...
Warning! Extremely twisted version of Digimon ahead! If you value your sanity, do not be ashamed to back out now.
...Whusses.
In a world where ours is a goal only the strong can reach, far below the lowest level few dare to brave, was the Core. And within the Core, a large red crystal hung in a rounded, glass stalactite and shone continuously up and through the layers of the world surrounding it, allowing the strange inhabitants a power our world has only recently conceived of. Beneath it was the softly glowing Center of Being, something that is lost somewhere in the border between dead and alive. And odd creatures resembling furry fish were flying around the gem in a carefree manner.
… Or at least, they were usually carefree.
Now they were frightened. They chattered nervously with each other, and some were even biting their nonexistent nails or wringing their hands. Their flight, usually playful and graceful, was now quick and only used to get them from Point A to Point B. Their talk revolved around one subject.
The Reaper is returning.
Something shifted. But, instead, of something moving, all motion stopped. The flyers seemed to listen to something, before turning as one to face the red suspended just out of the yellow glow's reach. One approached it, paying no mind to the transparent material it went through, and held out its wing-like hands expectantly. A small, glowing ball appeared, and the flyer immediately turned around and flew towards the surface. All the others approached the gem as one and started wrapping their power around it. A tendril from the yellow Center reached towards the crystal to aid them.
Meanwhile, the lone flyer broke the surface of the lowest level. It quickly scanned the sky and soon found what looked like a pink moon. Holding its precious message, it flew as fast as it dared to. When it reached the next level, it curled protectively around the orb, and once it broke through the ground, it returned to its usual position for the fastest flight possible.
After reaching the highest level, a barren desert, it looked once more to the satellite which no longer looked like a moon. Several layers of coding and grids partially hid the pixilated surface from view, but it was easy to make out if someone was familiar with geography.
It was Earth. And someone was about to receive a special message.
AGTCTCAGTCAGATCCAGAGCTGA
TCAGAGTCAGTCTAGGTCTCGACT
Fingers flew across the keyboard, and the rapid tak-tak-tak of typing filled the small apartment. Bloodshot eyes stared at the computer screen as lines upon lines of data materialized on it, expertly watching for any errors that would screw up the complex program. The figure behind the computer blindly reached for the mug of long cold coffee and swallowed the bitter fluid without a second thought.
The man leaned back in his chair and stretched, waiting for the caffeine to kick in. He glanced over to the window and wasn't completely surprised to see the sun peaking above the horizon.
His computer beeped as if angry to be ignored, but it was really just one new email. The man minimized the window containing the code he slaved all night over and still wasn't done with and brought up his inbox. There was no subject, and the man frowned when he didn't recognize the sender.
His cursor moved over the delete button, but he refrained from clicking when a certain type of virus, activated by deleting the email it was attached to, surfaced in his mind. He quickly activated the virus scan and directed it towards the new email. After it came up negative, he decided it was safe to get rid of it. Before he could do anything, though, it opened itself to show a mess of two numbers. He quickly recognized it and couldn't stop the small gasp that came out of his mouth followed by the usual question. "What the…?"
It was a complex algorithm, one he never thought he'd see again despite making it. The last he saw it, he was rushing to add it to a computer project that got shut down a few minutes later. But below the familiar sequence of ones and zeros was another sequence set up in an odd format. The techie that the man was, he almost subconsciously translated the binary code into letters then words that average people could read.
WE NEED YOUR HELP. DO YOU ACCEPT?
-YES
-NO
He clicked 'yes' without hesitation. Code instantly filled up the screen and kept filling page after page of binary code. The man read on, all thoughts of the other code waiting patiently for its finishing touches gone.
And a few feet away, in the doorway of the apartment, a familiar yellow jacket hung innocently.