TITLE: REBIRTHS
AUTHOR: C. L. Furlong
DATE: February 09, 2001
FINISHED: February 23, 2001
LAST REVISION: 24 February, 2001
E-MAIL: chance_lizard_furlong@aeiou.pt
RATING: PG
SUMMARY: Dr. Harley Street ("The Ci-kat-a") and Dr. Viper join forces
to conquer Megakat City. Who will defend it against those villains?
The Enforcers? A new group of vigilantes? Or someone else?...
DISCLAIMER: SWAT Kats and anything related to the series are the property
of Hanna-Barbera. No infringement is intended and no profit is gained
with this fiction.
COMMENTS: (They're a little bit long but they are worth the reading) It's a somewhat
shorter fic than my previous one and this time with no blood on it (well, maybe
only a little bit) though it's rated R (see below to discover why). This and
maybe a few future fics may tend to center more on T-Bone/Chance than on
Razor/Jake. Yes, T-Bone is my favorite character but I like Razor too and the
SWAT Kats don't exist without each other. I'll try to give the same amount of
attention to both of them but forgive me if one of them (generally T-Bone)
gets more attention than the other.
Now a little explanation. In most places you read "It's quite simple..." to do
this or that, well... it's really not *that* simple. I'm just assuming kats are
a little more evolved than we are. Besides I don't want to bore you with
technical details.
The second part of the prologue of this fiction has been inspired by Robin
Cook's "Terminal," a book which I *strongly* recommend, as well as the rest of
his series. And, speaking of the prologue, you might like to know that you don't have
to read it to understand the plot of this fiction. If you have a queasy stomach,
please, follow my advice and *DON'T* read it.
Once again, despite my best efforts in trying to write in proper English,
if you find any grammar or spelling errors in this fiction, please try to remember
that I'm writing in a foreign language, and I do not live in an English-speaking
country. And *do* let me know what you think of this fiction so I can do
something better next time, okay? Questions and comments will all have their answer
(it'll only take you a few minutes and you'll be *really* helping me out!).
Thanks to Kristen Sharpe for her support, comments and proofreading on my
previous fiction. Also her fiction "T-Bone Too - From the Darkest Hour of the
Night..." (*read it* in case you haven't) has inspired me on my brief descriptions of
Viper's Lab, although they may differ a bit from hers.
Thanks to KS Claw for her fics about Viper (namely "Claws of the Marekat
- 1 and 2", "Enter the Cobra" and "3 Mutants is 1 Too Many") which helped me to
look at Viper from a slightly different angle.
Though I didn't mention it on my previous fiction's "Comments" ("mea culpa"),
I'd really like to thank Glen Battilana for inspiring me with his fics on the
fighting sequences between the SWAT Kats and Dark Kat. Though our writing styles may
differ a bit, I think we see eye to eye in most aspects.
Cheers to all of you, SK fans!
-----------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------
"We're ba-aaack!" - T-Bone (Chance Furlong) in "The PastMaster Always Rings
Twice"
-----------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------
PROLOGUE
»»» Five days after the destruction of Megakat City Courthouse «««
"How many kats know this?" - the bearded orange-furred tom-kat asked.
Commander Feral rubbed his five-day beard, thinking.
"Me, my niece, Miss Briggs and now you. The families don't know anything yet."
- he responded.
Dr. Conway turned his back to the huge kat and walked to the large window of
Feral's office. He stared outside for a while, watching the sun set behind the
skyscrapers. What he was about to ask clearly violated all codes of ethics a scientist
could have. Even though it was their best hope.
"I think it's better if the families are never told of what we're about to do,
Commander."
He paused and closed his eyes, praying he was doing the right thing.
"Can you do it today, Commander?" He turned to look at the huge brown kat.
"I'll do it myself tonight. Count on it in your lab by tomorrow morning."
"One more thing. I'll need to contact someone else to help me do the job."
Feral frowned. He didn't want any more kats than those strictly needed. His own
job was at stake if something made its way outside.
"Who?"
"Prof. Hackle," - Dr. Conway said.
Feral seemed to relax a bit. He knew the old kat wouldn't refuse. And he knew
he could count on his discretion.
"I'll need the lab completely sealed! No one should get in nor out while we're
doing it!"
"That's not a problem. Forget you're in Enforcer Headquarters?" - Feral said,
assuming a cocky stance.
"I'd feel a lot safer if the SWAT Kats were still alive... So, I guess I'll just
have to count on your Enforcers... I'll be looking forward to see the package on
my desk tomorrow morning. You know what to do."
Dr. Conway headed for the door.
Feral sat in his chair behind his desk.
"Don't worry, Conway. I know what to do."
-----------------------------------------------------------------------------------------
"Bye, Gus. Hope this is tonight's last shipment!" - the morgue attendant said
to the hospital driver as he took the stretchers inside.
"Want it, didn't you? See you later!"
The ambulance drove out the service door of the city morgue.
While the attendant was carrying the newly arrived corpses inside, two forms
dressed in tight black suits slipped inside and hid behind the spare stretchers. They
waited for the attendant to return and close the garage-like service door.
"Now, look at the time! Five to midnight! It's almost 'lunch' time! I guess I
might as well get a bite of something before I go back to my desk."
The attendant stepped out of the service bay and went upstairs, towards the
cafeteria.
The two figures came out of their hiding place and headed along the dark
corridor that connected the service bay to the morgue. They entered the I.D. room
and searched the walls of long drawers, looking at the dates.
They found the date they were looking for. They opened the drawers and unzipped
the black bags in order to make sure those were the ones they were looking for.
They were.
Swiftly, they zipped the bags shut and removed the corpses. They took them to
the 'pit,' the affectionate name the pathologists there used to call the autopsy
room. Once there, they placed the bags onto two stainless steel tables and unzipped
them. They turned the corpses around so their backs were facing up.
They took off two bistouries from a tray and made an incision from ear to ear
passing by the scruff of the kats' necks. The larger dark figure grabbed the
upper portion of the incision and tugged it. With a noise similar to a root being
unearthed, the dead kat's scalp separated from the rest of the skull. The burly
form pulled it completely over the face of the kat. The smaller one looked to
the other side when the bigger one did the same to the other kat.
"I need your help now, Felina!" - Feral said as he reached for a bone-saw and
plugged it. - "Grab his head tightly!"
He turned on the saw and it made a heck of a noise. Fortunately, the 'pit' was
located in the basement, so every sound would be muffled by the building on top
of them. Besides, it was 'lunch' time and all of the morgue workers would be in
the cafeteria two stories above.
"I'll make it up to you, sweetheart, I promise!"
"Just get this done! And *don't* call me that! I'm not a kitten anymore!"
- she answered as she grabbed the kat's skull by both sides of his face.
The saw contacted with the bone and it almost slipped off Feral's paws. Getting the
job done was going to be harder than he had expected. Felina grabbed the kat's
head with all her strength. Feral maneuvered the saw around the kat's skull,
trying to cut only the bone and not to damage the brain. The saw cut the top of
the kat's skull and Feral took it off like it was a lid. He tried to remember
his old high school days, when he did the same to a sheep in a Biology class.
With a bistoury in his gloved right paw he inserted it under the brain and
released it from the spinal medulla and the cranial nerves. Then, placing both
paws inside the skull, he took the brain out.
"Get me the box," - he ordered his niece.
She reached for a camping freezer. She took the lid off and Feral buried the
kat's brain under the sliced ice that was filling the freezer. She placed a name tag
near it and covered the freezer with its lid while Feral moved to the other kat.
She grabbed the kat's head again and Feral repeated the procedure, placing the
second brain inside the freezer, tagging and covering it too with the ice. He
turned to the bodies and zipped them inside the bags again.
"Now what?" - Felina asked with a somewhat sick voice.
She knew she was going to have nightmares for several nights because of this.
"We gotta get rid of the bodies," - he said.
He spotted the incinerator hatch further to the right. He opened and inspected
it. Fortunately, it was big enough for a kat to slide down it. He picked up one
of the kats and rested it in the hatch border before pushing it down.
"I'm sorry..."
Then, he pushed the black lump. He did the same with the other kat.
"We gotta destroy their files too!" - Felina said.
Feral just waved a huge paw in the air. "Let Commander Feral take care of that. Right
now, we gotta get outta here. 'Lunch' time is almost over!"
They left the 'pit' and headed for the service door. Feral was carrying the
freezer with the brains. They got out by the service door and headed for Feral's
off-road, which was parked in an alley two blocks away. Placing the freezer inside the
trunk, Feral drove out of the alley and joined the night traffic of Megakat City.
They passed by the morgue on their way back to Headquarters. The pipe of the
incinerator was launching volleys of gray smoke into the dark skies along with
some flakes of fire. Feral slowed down as he passed by the front portico of the
morgue and closed his eyes for a second.
"May the Holy Kats forgive our acts tonight."
They drove back to Headquarters in utter silence.
------------------------------------------------------------------------------------------
------------------------------------------------------------------------------------------
REBIRTHS
»»» Present day «««
"It's over now, Metallikats! You're surrounded!"
Feral's grave tone echoed in the air in front of Megakat Savings, amplified and
slightly distorted by the loudspeaker.
"Then, come and get us, Feral!" - Mac bellowed as he opened fire on an enforcer
car, blowing it up.
"You asked for it, scum bag! LET 'EM HAVE IT!" - Feral ordered as he aimed his
own blaster at Mac.
He hesitated for a moment.
"Enforcer weapons should only be used to stun." - he thought, remembering the
rules.
"The heck with it! You helped kill my son!"
He regulated the power of his weapon to its limit, took a careful aim and shot.
Mac fell instantly to the ground.
Feral shot him in the shoulder but the blast was so great his whole right arm
was tore off his metal body. Molly saw it and made a true barrage of laser fire.
Feral aimed again, this time to Molly's head.
He shot.
In a split second decision, Mac jumped in front of Molly and used himself as a
shield. The blast caught him in his forehead and made him fall over Molly. Both
Metallikats fell on the ground.
"GET THE SPARKS ON 'EM!" - Feral shouted.
The nets were fired and covered both Metallikats, delivering a powerful
electric shock. Mac didn't offer resistance. The central processor in his head was
already fried by Feral's blast. Molly, on the other paw, fought back, but she couldn't
hold the continuous discharge and, eventually, her central processor was toasted as
well.
"A job well done..." - Feral thought - "No casualties, no damage to the
buildings, nothing! Just a few scared kats and a burned out car. Nothing more."
He headed for Sergeant Reeves.
"Get 'em outta here!"
Reeves saluted his commander with an emphatic 'Yes sir'. Feral went to his car
and drove off to HQ.
"It's been already one year since you died, son... The Metallikats, however,
are alive... I wonder if the other creeps you and Clawson worked so hard to
eradicate from this city are alive too...
If they are, then all your work and your death would have been in vain...
But don't worry, son... I'll make them pay for it..."
He arrived at HQ and headed directly to his office. He sat behind his desk and
his fingers flew over his PC's keyboard. He wanted to check his mail, like he
did ten times a day since his trip to the city morgue.
He prayed to have the mail he wanted while the service was logging him on. Then,
the mailbox appeared. 'You have one message' it flickered. He clicked on it and
it appeared a few seconds later. It was part of a DNA strand.
CAGCAATATAGATTTTTATGAGATTTCACAGACTTT
"Yes!" - he whispered.
He retrieved a sheet of paper and a pencil from a drawer and made two grids.
TAGC 1234567890
1234 ABCDEFGHIJ
5678 KLMNOPQRST
90 UVWXYZ
"Now, if I remember what he said, I must replace T for A, A for T, G for C
and C for G."
He did so and obtained the complementary DNA strand.
GTCGTTATATCTAAAAATACTCTAAAGTGTCTGAAA
"Now, I have to replace each letter for a number according to the first grid."
He obtained several combinations, but he knew only one could be understood.
"It must be this one! The triple 0 ending tells me that!"
354315 05 65812000 052 4545000 3535 453000
"Darn code! Now I have to replace each number for a letter according to the
second grid."
He did so. Again, he obtained several combinations, but only one was readable.
The message!
CONWAY TO FERAL. JOB DONE. COME NOW.
He sat back in his chair, staring at the sheet of paper.
It was accomplished.
The moment he waited for so long was now about to happen. He covered his face
with his huge paws and sighed.
Could it be true?
What if it was nothing more than a failed attempt like the last five? He
decided he wouldn't feed any hopes.
But, the message seemed serious. Not like the others.
Not 'I think we made it' or 'we believe it worked.'
No.
'Job done', that was what it said now. He took off his communicator and pressed
a button on it.
"This is Commander Feral. Lieutenant Feral, do you copy?"
The radio crackled once and her niece's voice filled his ear.
"Lieutenant Feral here. Over."
"Lieutenant, report to my office at once. Feral out," - he ordered her.
The radio crackled again and her answer came.
"Ten-four."
Then, the radio went silent.
Feral tore the paper apart, placed it in an ashtray and set it on fire.
-----------------------------------------------------------------------------------
In a few minutes, Felina entered her uncle's office.
"Lieutenant Feral reporting, sir."
"At ease, Lieutenant." - he said, walking from behind his desk towards the
window.
His face was just a few inches from the glass when his secretary announced over
the intercom that the Deputy Mayor had arrived. He went to the door and held it
open to allow Callie to enter in the office.
"Sit down, please. Both."
They did as they were told. He returned to his seat behind the desk. They
looked like students in front of the principal.
Callie took the lead. "Well, Commander? What is it?"
"I gotta admit I'm curious too, uncle!" - Felina strengthened Callie's
question.
Feral cleared his throat.
"I've received the message we were waiting for," - he said in a calm tone.
Both she-kats exchanged looks.
"The job is done," - he completed.
"You mean, this time's for real?" - Felina asked, verbalizing Callie's
questioning look.
"Let's hope so. I don't need to remind you that this must remain between us.
*No one* should know what we've been doing during this year."
He looked from one she-kat to the other.
"We already swore to keep it a secret. As far as I'm concerned, nothing
happened during the past year!" - Callie said - "Shouldn't we get going?"
"Let's go," - Feral said, rising from his chair.
He held the door for both she-kats and then left, locking the door. They headed
downstairs to the Biotech Lab. Five enforcers were guarding the entrance. They
stood to attention as Feral and the two she-kats entered the lab. It'd been two
months since Feral stepped inside for the last time. Everything seemed the same,
almost like time hadn't passed in that place.
"Ah, Commander Feral! Lieutenant Feral! Deputy Mayor Briggs!" - Dr. Conway
greeted the visitors - "Long time no see!"
"How do you do Miss Feral, Miss Briggs, Feral?" - Prof. Hackle welcomed them
too.
They returned the greeting to the two scientists.
"Enough small talk, Conway." - Feral said - "Did you get it this time or
not?"
The bearded tom-kat took off his glasses and cleaned them with his white lab
coat, putting them back on.
"Well, Conway?" - Feral asked again, impatiently.
"Let me show you."
Dr. Conway took the group further inside the lab. What they saw gave them
chills. In the far corner of the lab stood two large tubes with a translucent green
liquid. Inside each one, was visible a full-grown kat-like form. They were both in
the fetal position.
Feral approached, followed by Callie and Felina. One of the forms was burly and
the other was slimmer. They both had oxygen tubes attached to their nostrils.
Feral touched the cylinder with the bulky form inside. It was warm. 37º
Celsius, Feral figured out.
"Are... Are they alive?" - Feral asked. His tone betrayed his bewilderment.
He looked to the face of the naked kat inside, floating slightly at his eyes'
level.
"They're as alive as you or me, Commander," - Conway answered, adjusting his
glasses.
Callie came to the other cylinder and looked at the slim kat. She could see his
muscular chest slowly rising and falling.
"What is this green crud anyway?" - Felina asked.
Dr. Conway seemed a little upset with her comment.
"It's not crud, Lieutenant. It's amniotic fluid with a few extra nutrients that
give it its greenish color."
"And, a little bit of motor oil, he, he," - Prof. Hackle said.
They all spun their heads with an inquiring gaze.
"Yes, motor oil. But not an ordinary oil. When they wake up we'll explain
everything. I'm sure they will be curious as well."
They turned their attention to the kats again.
"By the way..." - Callie said - "...when will that happen?"
Suddenly, the slim kat twitched his tail slightly, which startled Callie.
"It seems they'll wake up any minute now!" - Dr. Conway said as he headed for a
control console - "I think we should go to final procedure, Hackle, don't you
agree?"
The aging kat nodded.
Dr. Conway started draining the green liquid that held both kats. They slumped
to the floor of the tubes. Their eyes were still closed. Clean hot water began
showering from the top of the cylinders, cleaning both kats of the remains of the liquid.
They opened the cylinders and, with the help of Feral and Felina, took the
soaked wet kats to two stainless steel stretchers. The scientists then dried their fur
and covered them both with white sheets.
"They look just like the original ones!" - Callie said.
"They *are* the original ones, Miss Briggs!" - Prof. Hackle said - "Feral did a
good job with the brains. They were physically undamaged. Of course, the lack of
oxygen had already ruined some neurons, but that was a minor setback. Nothing my
technology couldn't fix, at least."
They heard the burly kat begin mumbling something unintelligibly.
"They're waking up!"
They all gathered around the kats.
Suddenly, the burly tom-kat sat upright on the stretcher.
"LOOK OUT!" - he screamed.
Then, he blinked.
Something was wrong.
He wasn't in the courtroom anymore.
By his side, the slim kat was awakening too. They looked around to get their
bearings. Only then, did they notice they weren't alone.
"Welcome back, SWAT Kats! We've been waiting a long time for you!" - Prof.
Hackle greeted them.
Chance and Jake exchanged confused glances. They were totally lost.
"Where are we?" - Chance asked.
"How did we get here?" - Jake added.
"And, why are we naked?" - Chance queried, peeping under the sheet and blushing
a bit.
They all laughed.
They were back, all right.
Chance's good humor was evidence enough.
---------------------------------------------------------------------------------------
"So we actually *died*?" - Jake asked from his standpoint near the window,
facing Dr. Conway.
They were in Feral's office, already dressed up with some clothes Dr. Conway
gave them. Chance was right beside Jake, staring towards the salvage yard in
the distance. He still couldn't believe an entire year had passed since
the trial.
His last memories from that day were blurred. All he remembered was getting up,
grabbing Jake by his waist and carrying him out of the courtroom.
Then, he heard the detonations.
And then, everything went black.
He closed his eyes and shook his head, turning around to face the
orange-furred biotechnician.
"You sure did!" - Dr. Conway said as he adjusted his glasses on his snout.
"So... how come I don't remember anything?"
"Quite simple, actually! Your brains simply ceased registering information
the moment they died!"
"How did you bring us back to life?" - Chance queried, speaking for the
first time.
A smirk appeared on both Dr. Conway's and Prof. Hackle's muzzles. This was
the moment they were waiting for, their moment of glory... when Science
overcomes the most basic laws of Nature...
"It wasn't easy!" - Dr. Conway started - "As you might know it's virtually
impossible to... well... resurrect someone!"
"However, modern day Technology and Biology can do miracles..." - Prof.
Hackle said.
"And we combined them both!"
"Have you ever heard the term 'technorganic'?" - the aging kat asked.
Both kats shook their heads in a no after exchanging glances.
"Well, let's start from the beginning." - Dr. Conway said as he leaned
back on his chair - "We had a problem. The SWAT Kats were dead and we
had to get them back in action right away. Time was something we didn't
have. We could have cloned you...
"But then, you'd have had to raise us from embryos until we reached adulthood
and train us, meaning you'd have to sit up on your tails for, at least,
twenty years," - Chance stated.
Dr. Conway simply nodded.
"That's correct. We couldn't afford to lose so much time! Besides, the
yield of such a procedure is extremely low. As you might remember, the sheep
Dolly was successfully cloned after 400 attempts! From the implanted 277
embryos, 247 were recovered, from which only 29 were viable embryos and
only one developed into a fetus... You must admit that, with this procedure,
the odds were all against us...
"So, you didn't clone us..."
"We did something far more grand! We *recreated* your cells! Simply put,
you were reborn adults!"
Jake and Chance exchanged confused looks. Dr. Conway hurried to explain
himself.
"We simply designed your different cells. Although your bodies contain
millions of cells, they all fall in a bunch of major groups, such as
neuronal cells, muscle cells, lining cells, etc.
A cell contains lots of organelles in its interior but basically, they all
look the same. We just encapsulated those organelles and rebuilt your bodies."
"And, where did those organelles come from?" - Jake queried.
"Good question! You have *our* organelles inside *your* cells.
We donated them to you."
"But the DNA..." - Chance started, but Dr. Conway promptly raised a paw,
silencing him.
"We removed the nuclear and mitochondrial DNA from our cells. It's really
simple to do it, you merely vacuum it with a micropipette. Your cells have
your DNA, which was retrieved from neurons in your brains. As a matter
of fact, your brains are everything you have left from your former bodies."
"I still haven't figured out why Prof. Hackle was summoned to this job!
After all, his field's not Biology!" - Jake said.
The aging kat leaned forward in his chair.
"You're right, young kat. However, as Conway already said, we combined
Biology and Technology."
"Precisely. Well, we still had a problem... In order to extract the organelles
from our cells, we had to disrupt the cell membrane, which posed a huge
problem... since the organelles had the same type of membrane coating their
interior..."
"So, in order to keep the organelles undamaged, we decided to coat them with
nanochips before disrupting the cell membrane," - Prof. Hackle completed.
Jake's jaw dropped in awe.
"Nanochips?" - he repeated, dumbfounded.
"Yes! Nanotechnology in its purest state!" - Prof. Hackle proudly stated
- "All your organelles and cell membranes are made of nanochips. We programmed
them to mimic the functions of your different kinds of fully differentiated
cells.
Your red blood cells lack its nucleus, your fur cells are smooth and strong,
your taste buds have all the necessary nerve endings... you name it, you got
it! Your bodies are now what we've designated technorganic."
"So... we're cyborgs? Like the Metallikats?" - Jake said in disgust.
"*No*!" - Dr. Conway said, in shock - "You're normal kats! Everything in you is
natural! Well, everything except your membranes... but you can do everything a
normal kat does! You can even reproduce yourselves like a normal kat! Damn,
you're as normal as Commander Feral or the Deputy Mayor!"
"Well... It really looks like real fur..." - Jake said as he stroked the fur
on his arm.
"It *is* real fur! It was engineered to *be* real fur!" - Dr. Conway said
with a soft sigh.
"There's something bugging me! Where are our former bodies?" - Chance asked.
"They were destroyed after your brains were taken out," - Feral said,
hoping the big tabby wouldn't ask too many questions about it. "*Salvaged* is the
appropriate word..." - he turned around and stared outside the window again.
"What about our identities? I mean, it'll be hard to explain why we were gone
for so long!" - he threw the question to the air, to no one in particular.
Feral responded to the big tabby.
"Your files in the morgue disappeared. As far as the world is concerned, you
never died. Your taxes are all paid and your duties were all filled in. For
all purposes, you were alive for the past year."
Chance looked to Feral and then to Callie. He knew she had to have pulled many
strings to cover their death.
She knew they were the SWAT Kats now. And, so did Conway and Hackle.
Too many people. They were all in danger now.
And, he had to protect them all.
------------------------------------------------------------------------------------------
Felina drove Chance and Jake back to the salvage yard. The sun was setting
behind the buildings in Megakat City.
Jake stared at them. It was so strange. Last time he saw it, the city was
shattered. Most skyscrapers were then scraping the ground.
Now, a year later, most of them were rebuilt, scraping the sky again. Callie
must have really pressed the contractors to accomplish the job so swiftly.
He climbed up a pile of metallic litter and sat on top of the hood of a car.
Chance joined him a little bit later. They both sat there in silence,
watching the red globe slowly sink in the horizon.
"Where's Felina?" - Jake asked, keeping his eyes on the setting sun.
"She left."
They fell silent again until the sun hid completely behind the horizon.
Chance broke the silence.
"I can't believe we actually..."
"Died? Neither do I!"
Jake rose from the hood and did a backward somersault, landing on his right
leg and keeping the left one retracted.
"But, I couldn't do this anymore if my leg was still injured..."
Chance got off the hood and opened it. He tried to lift the loosened
engine inside and tossed it to the next pile of litter with his left arm.
The engine smashed against the windshield of another car which stood ten
meters away.
"I couldn't do that either if my lung still bothered me..."
Chance closed the hood and they sat on top of it again, now looking at
the rising moon against the purple and blue sky. They followed the silver
planetoid with their gazes for some time.
"You know what, Jake? It doesn't matter if we died or not. It doesn't matter
if all those crooks survived."
He passed an arm over Jake's shoulders. Jake did the same. They stared at
the silver orb. Their eyes glistened as the opalescent light penetrated
into their pupils.
"All that matters is... we're back!"
------------------------------------------------------------------------------------------
His eyes flared as he returned to that hideous place.
The infamy of that kat! Holding him in slavery!
Well, it didn't work!
He was free.
He was free all along!
Did he think he could *possibly* control him? With that *stupid* little serum?
"Well think again, Dark Kat! Dr. Viper playsss sssecond fiddle to no one!"
Viper was inside the volcano, former hideout of Dark Kat. He came out in
the lab the purple crime overlord prepared for him. Everything was in the
same position he left it. He headed for the big walk-in freezer.
The green kat had been searching for the place for over a year but, thanks
to the countless passages inside the volcano, he only found it now.
But, the time spent in that search would finally start to pay off.
He opened the walk-in sub-zero freezer. White vapor dropped in thin sheets on
the floor around Viper's feet. He instinctively raised one foot. Then, settled
it down and raised the other.
Too cold.
He sibilated. He had to go through with it. Now that he was so close, he
wouldn't let a little cold stop him.
He stepped inside.
Too cold. Too cold.
The back of his mind was screaming for him to get away from the source of
that cold. But, he couldn't go back now. He was so close.
So close.
He opened a drawer and peered inside. There it was...
The Erlenmeyer... Right where he hid it...
He grabbed it and prepared to leave.
Something stopped him. His feet. They were stuck to the ground. The ice glued
them.
Too cold. Too cold. Too cold.
He gathered all his strength and managed to rip one foot off the ground. Then,
he did the same with the other. Frozen scales marked the spot where he had stood.
"Get outta here!" - his mind screamed.
His muscles weren't responding fast enough. He awkwardly stepped to the door.
"Almossst there! Jussst a few more stepsss!" - he muttered.
He left the freezer and closed the big door. He then headed for the lab bench
and laid the beaker on it, panting. He growled.
"Why the heck do I have ssso much hemoglobin in my blood if my mussscles
don't use it?" - he bawled. He was better now. The heat emanating from the
depths underneath him reanimated his frozen muscle fibers.
"It'sss on occasionsss sssuch as thisss that I regret being a reptile...
No matter...
I already have what I've been looking for..." - he looked to the Erlenmeyer.
There was a frozen liquid inside.
A blue frozen liquid.
"It'sss not much, but it is enough to do what I have in mind. Now, where did
I put that map?"
Carrying the Erlenmeyer and following the map he drew while he was exploring
the passages of the volcano in search of the lab, Viper quickly reached the
hangar built in the basalt rock.
"Come out, come out, wherever you are, my little beassst!" - he whispered as
he inspected the hangar.
There wasn't much light but his eyes were used to the darkness. He spotted the
cage far to his right, in the far corner of the hangar. He walked towards it.
"Ssso that'sss where you're hiding!" - he hissed softly.
The agrecite scorpion lunged towards Viper, screeching out loud. Only the
cage's bars prevented it from shredding the reptilian scientist. Viper
stepped back a little.
"My, my, we're hungry aren't we? We should be after an entire year without
food..."
The scorpion squeaked again, now in a lower tone. Viper took off a little
glass capsule with a diaphanous liquid inside from his lab coat and threw
it inside the cage. The capsule shattered and the liquid immediately
volatilized, creating a heavy gaseous atmosphere around the scorpion. The
huge orange beast blinked twice and then slumped to the ground.
"But, for now, we'll jussst sssleep a little bit, okay?"
With the help of the claw on his forefinger, Viper managed to unlock the
cage door. He headed for the scorpion and petted it. Then, he forced its
mouth to open and dropped some of the now liquid neurological serum inside.
He closed the scorpion's jaws and the beast swallowed the fluid.
He waited until the combined effects of the sleeping gas and the serum
allowed the agrecite scorpion to slip out of its dormancy. The animal saw
him and didn't react. Viper called it and it came to him. The scorpion now
obeyed him. Both beings left the cavernous passages of the volcano and
headed back to Megakat Swamp.
------------------------------------------------------------------------------------------
"'Morning, Jake!" - Chance greeted his friend as he stepped out of the
shower, wrapping a towel around his waist.
Jake was brushing his fangs. He spat the foamy gel and greeted him back.
"Hiya! What's the matter? Fell out of the bed this morning?" - he said
before washing his mouth.
He knew Chance liked to sleep in, especially on the weekends, which was
the case. Chance rubbed his fur with another towel.
"Actually, I couldn't get a decent shut-eye last night."
He put the second towel aside and started drying and combing his fur.
Jake stepped inside the shower area and turned on the cold water.
"Why's that? Thinking about what happened to us?" - he said from inside
as he let the cold fluid run down his body.
"That too."
Jake was taken aback with that comment. He turned off the water and put
his head outside.
"What else were you thinking about?"
Chance turned off the dryer and dropped his head to his chest. His ears
dropped a little too.
Jake mentally kicked himself. Of course. It could only be her.
"I was thinking about Turmoil..." - Chance said mournfully as he
sat on a bench.
Jake wrapped a towel around his waist and crouched in front of the
big tabby. He looked directly into his eyes. Chance turned his face
away from Jake's gaze.
"She was really special to you, huh, buddy?"
Chance closed his eyes. He didn't answer. He didn't have to. Jake knew it
perfectly from the month he and Turmoil spent together. If his love for
Turmoil was as great as the love she had for him, then Jake knew just how
special Turmoil was to Chance.
"How was it, Jake?" - Chance suddenly asked, looking at his friend.
"What?"
"How was it between you and Turmoil when I was recovering from the crash?
We never did speak much about it, and..."
"Just tell me what you want to know and I'll answer."
"Did you ever..." - he hesitated - "Forget it..."
"No, we didn't. She slept in your bed; I slept in mine. You know I wouldn't
do that to you, buddy."
"I'm sorry... I didn't mean to insult you..." - he closed his eyes and
turned his face away from Jake's again.
"Hey! It's okay! You didn't! Besides, you know my heart belongs to another
she-kat... Maybe you know that even better than I do!"
"Tell me more about her." - a single teardrop raced down Chance's facial fur.
- "I never met her outside the prison..." - Chance shook his head - "It's
weird... I loved her, but I didn't knew her..."
"She was one amazing she-kat. A heck of a pilot, a golden heart, a good
friend... In one word, buddy... She was you..."
Chance looked to Jake. It was a surreal picture! Two half naked tom-kats,
inside a bathroom, one damp, the other soaking wet talking about one's
deceased love. Chance swallowed his sadness and got up.
"Well, guess that takes care of it. Go on - go take your bath."
"Are you sure you're okay?"
Chance coiled the towel he had put aside and whipped Jake's tail with it.
"Go take your bath!" - he ordered with a giant smirk on his face.
"HEY! I'm goin', I'm goin'!"
-------------------------------------------------------------------------------------
"Chance, can I ask you something?" - Jake asked after he sipped some coffee.
"Shoot!"
"Well... I've been wanting to ask you this since our last meeting with Dark
Kat."
He hesitated a bit. Chance noticed it, but just drank a bit of coffee from his
mug.
"Where did you learn to fight like that? I mean, you never fought me like you
did with Dark Kat when we practiced here!"
Chance smiled and closed his eyes. He couldn't believe it! Jake was jealous of
Dark Kat because Chance fought him in a way Jake would never dream of!
What a fighting spirit Jake had... Fighting for the pleasure of fighting...
The thrill of struggling against a new adversary...
The honor and purity of unarmed combat...
"Let's just say I had a good teacher," - Chance answered.
"Who?"
Chance's smile grew larger as he looked directly at Jake.
"You," - he simply responded.
"You're kidding me!" - Jake said as he stared at the big tabby - "I never
taught you anything!"
"Just because you never guided my blows doesn't mean you haven't taught me."
"Huh? Aw, come on, Chance! I asked you a straight question! I think I deserve
a straight answer, don't you?"
"Okay, don't cough up a hairball for that! I studied you while you were
practicing. Those moves are yours."
"But, it took me lots of time and practice to master them. You never spent
that much time in the dojo!"
"You're right. But, I'm sure you noticed that I've spent much more time at my
'refuge' than I used to, didn't you?"
"You practiced in the *desert*? Under that heat?"
"You bet."
"I'm not totally convinced... but I'll believe you. There's another thing
I'd like to know."
"What, am I in a twenty questions game? Go ahead, shoot."
"How did you mutate into that brawny colossus, anyway?"
Chance just shrugged.
"You got me, pal! All I know is that Dark Crud kept calling me envoy of
Horus, whatever that is. Feral mutated too and he called him envoy of
Amon... whatever that is too!"
"Horus, Amon, Hel, Pluto, Hades, Seth... I know I heard those names before..."
- Jake said thoughtfully, rubbing his chin.
"I know I heard Horus, Amon and Seth before, but the others... never heard
of 'em..." - Chance said as he finished his coffee - "So, do you want it or not?"
"Want what?" - Jake queried with a confused look.
"Fight me!"
Jake's eyes nearly sparkled as a smile flourished on his muzzle.
"O-oh, you bet, buddy! I can't hardly wait to fight you! C'mon! Time's
wasting!"
----------------------------------------------------------------------------------
Viper gave a low sigh as he finally reached the swamps. He climbed up the
big mutated tree that housed his lab. The scorpion followed his every move
in blind compliance
Once inside, Viper guided the huge beast to a separate compartment of his
living laboratory.
"I'll be right back with some carcassesssssssss, okay?"
He left the room and headed for the lab. He ordered his plantimals to hunt
down some animals and bring them to him.
"I can't hardly wait for you to regain your full strength. Then, with a few
controlled mutationsss, we'll be *unssstoppable*!"
"How thrilling! Bzzzzzzz!"
Viper spun on his heel and snapped his tail in the air.
"Who's there?" - he queried as his glowing eyes searched the room.
He didn't see anyone. He looked up, towards the ceiling.
Then, he saw it.
He instinctively began salivating. Suddenly, he shook his head.
No.
He wouldn't let his reptilian instincts overcome his kat condition again.
Like he did when he shredded that blasted creepling. Though he couldn't
deny it felt *very* good...
"Who are you?" - he asked as a few drops of saliva oozed through his teeth
and down his chin.
"Don't you recognize me, Purvis?" - the sentence ended in a sharp buzzing
sound.
"The name'sss Dr. Viper! Purvisss is dead!"
The dark orange form dropped from the ceiling and landed on all fours on the
ground.
"Don't you remember your old friend Street? Bzzzz."
"Ssstreet? Harley Ssstreet? Is that you?"
Dr. Street stood to his feet. He stepped forward, revealing his features. His
mouth parts clamped twice. His multifaceted green eyes captured thousands of
images of the green kat, one for each ommatidium, but his brain put the pieces
together and he saw only one detailed image. His membranous wings were fully
extended behind him. His arms were skinny as an insect's legs.
"I thought the SSSWAT Kats had finished you off, Ssstreet," - Viper said, the
glow in his eyes fading a little.
"I prefer Ci-kat-a, Viper, if you don't mind!" - he made some more buzzing
sounds before he could speak again.
"What do you want from here?" - Viper shot.
"From here, nothing. From you, that's a different matter. Bzzz-zzzz! I'm
offering you an alliance in the name of our old friendship."
"Oh, no! Not again!" - Viper thought - "What do these creepsss take me for?
A fool? Sssomeone who can't win by hisss own meansss?"
"I'm not interesssted! Now leave!" - he said, turning away from the
mutated bug-kat.
"You can study me..." - he buzzed teasingly.
Viper stopped. Ci-kat-a had pressed the right button, his weak spot.
His scientific curiosity.
He couldn't let the opportunity of studying an alien bug slip through his
fingers.
"Okay, you have my attention. What do you want?"
"I want the ability to breed."
Viper cocked one eyebrow. A mocking grin appeared on his snout.
"You want to change your sexsssssssss?"
"Moron... You know perfectly well it's not that. The original Ci-kat-a could
reproduce itself whenever it wanted. I want to do the same."
"What for? - As if I didn't know..." - he muttered the last sentence to
himself.
"I want to produce an *army* of ci-kat-as so I can defeat those infernal SWAT
Kats and turn this city into a giant hive for my kind, from where we'll conquer
this planet!" - he made a final buzzing sound that seemed like laughter.
"And jussst what would be my plassse in that bug-ruled world?" - Viper asked
suspiciously.
"You can rule by my side. After all, if I manage to conquer this world it'll
be because of you!" - he buzzed.
Viper thought for a moment.
"Are you a kat or an insssect?"
"Why the question?"
"To know jussst how hard my tasssk will be. We have a deal."
-----------------------------------------------------------------------------------------
Chance slumped to the ground in the arena with his arms spread out wide. He was
exhausted, his fur soaked with sweat, his bare chest lifting and abating
rapidly, his mouth wide open, trying to soak up all the air he could, his abdominal
muscles relaxing and contracting with each breath he took.
Four hours fighting...
Running, punching, missing, blocking, kicking, flipping, getting hit,
somersaulting, dodging, hitting...
For four hours...
And, Jake still wanted more...
He came to the big kat, crouched beside him and tapped him on the shoulder.
"Don't tell me you're givin' up already?"
Jake's fur on his bare torso was damp with perspiration too and he panted
like an old kat, but he seemed tireless. His muzzle had a jovial smile and
his eyes were nearly sparkling.
Chance looked at his partner in amazement.
"Don't... Don't you get... tired?" - Chance managed to say between pants.
"Tired of what? This was just a warm-up!" - Jake said, his smile growing
larger.
Chance widened his eyes and opened his mouth. He couldn't believe it! A
warm-up? Then, he hadn't even started to fight seriously yet?
Jake noticed his friend's astonished look and began laughing.
"What's... so funny?"
"You! Did you really think all of this was just a warm-up exercise? Of
course I'm tired! But, I'm happy as well! I never fought someone like you
before! C'mon, let's start it again!"
"Jake, you're a monster! I surrender! I'm not moving from here! Kill me
if you want but, I'm not moving from here!"
Jake's smile instantly disappeared from his snout. He got up and left the
arena, grabbing a towel on his way out. Chance heaved his bulk from the
ground and ran to Jake.
"Jake, what happened?" - he asked, concern spreading inside his chest.
Jake just closed his eyes and dropped his head to his chest. Chance couldn't
understand. His nightmare returned as vividly as when he first dreamt it.
"What's going on, buddy? Speak to me! C'mon, you're making me feel miserable!
Was it something I said?" - Chance asked while he stopped Jake by settling
his bulk in front of him.
Jake heaved out a sigh.
"I'm sorry... Your words made me remember a nightmare I had when you were
out..."
"Do you want to talk about it?"
Jake shook his head no. Then, he gave Chance his earnest face.
"Chance, promise me you won't let me kill you! Promise me you'll finish me off
first if I ever threaten your life!"
"What're you talking about?" - Chance asked in shock.
"*Promise me*! Please!"
"No! I won't!" - Chance said as he grabbed Jake's shoulders tightly and threw
him his most intense gaze.
Jake looked to his partner with humid eyes. He knew he couldn't understand
his dreams.
"I'll *never* kill you! And, I know you won't kill me too!" - Chance reassured
him.
"How I wish that were true..." - Jake thought, dropping his head and closing
his eyes again.
"Is everything okay with you, Jake?"
"Yeah... I guess I shouldn't let my nightmares command my life..." - he sighed.
"No matter how horrific they may seem, Jake, dreams are just what they are...
Dreams... And, nothing more than that..."
---------------------------------------------------------------------------------------
"Darn!" - Viper hissed furiously, waving his tail in the air. Ci-kat-a looked
at him from the vine-made stretcher with the inquiring gaze a bug's face could
show.
"What is it?"
"Let me get this ssstraight in my head... You sssay you want to breed without
mating, right?"
Ci-kat-a nodded.
"But, you can't do it, right?"
The mutated bug-kat nodded again.
"Ssso you're dioeciousssssss..."
"I'm *what*?"
"You're an organism that can only produssse one type of gametesss. In your
case, male gametesss. In order to be able to ssself-breed you mussst be monoeciousss,
that is, you mussst be able to produssse both male and female gametesss. If you
were an insssect or a frog or even a reptile that would be easy..."
"But..."
"But you're ssstill a darn mammal... You're ssstill a kat! You're just a
mutant!"
"So, what's your point?"
"My point isssssss - though you may have a few insssect traitssssss, like your
eyesss, mouth partsss, wingsss, ssstrength and resistanssse, your reproductive
sssystem is ssstill mammal-like!"
"Meaning?"
Viper sighed and hissed in frustration.
"It meansss I'm going to have to make a messsss out of my lab if I want to turn
you monoecioussssssss! And yesss, it won't be pleasant..."
"But it can be done..."
"Obviousssly..." - he stared around his green and brown lab and then sighed
- "I jussst hope the red ssspots won't ruin my decoration..."
-------------------------------------------------------------------------------------
"How's it lookin', partner?" - Chance asked Jake.
They stood in the hangar, where pieces of the TurboKat lay in the middle of
the vast room. They managed to salvage the jet's remains from its organic pyre
near the Dark Pyramid and deposited them in their hangar but their sudden death
prevented them from rebuilding the black jet. Now, the metallic carcass was
somewhat rusty.
"Not good but still, not too bad... A couple o' weeks work, at least...
The ABA mega-alloy protected the engines and most of the frame, but still..."
Jake sighed. He had another partially melted black, twisted monstrosity in front
of him to fix. Chance petted the remains of the jet.
"So banged up... My little beloved..." - he turned to Jake - "Let's start doing
it... I can't stand to see her like that..."
Jake nodded. They both left the hangar and went outside to look for some pieces
they could use to rebuild the black fighter jet.
"You know, last time I did this, Turmoil and..."
Jake mentally whipped his tail. He didn't want to talk about Turmoil near
Chance. He looked to the big tabby, but he didn't seem sad.
"You were saying, bud?"
"I... was saying... last time I searched for components for the TurboKat,
Turmoil and I were mad at Dark Kat," - Jake said in a tentative tone.
"Really? I wonder why?"
Chance gave Jake his trademark smirk.
Jake was surprised. That morning Chance nearly cried when he spoke of Turmoil
and now...
No...
He was hiding it... He was hiding his feelings from him, like he always did...
"Like *I* always did with him too..." - he thought - "Chance, Chance... We've
been friends for so long now and we barely know each other. I don't know anything
about your past, just as you don't know anything about mine...
And, does it really matter?
Not for me... All that matters is that we have our friendship... Now and
forever..."
------------------------------------------------------------------------------------
A week had elapsed. Jake and Chance embraced their mechanics life again. Their
days were filled repairing cars and/or the TurboKat. As Burke and Murray were
reassigned to another town shortly after their death, they never saw the two punks
anymore.
Viper continued his research on Ci-kat-a. He was amazed. The bug-kat was much
more fascinating than his previous exams had told him! And his self-preservation
capabilities were outstanding! Even completely torn open, the mutated kat still
lived. Unconscious, but alive.
Finally, the work was done. Viper sutured the incisions he made on the somewhat
chitinous skin of Ci-kat-a with precise stitches. When he finished, the bug-kat
started to move.
"Incredible!" - Viper thought - "He felt when his body wasn't at ssstake
anymore!"
"Is it done?" - Ci-kat-a asked in a groggy voice.
"It is! I wouldn't move for a while if I were you. I just sssutured you."
"When will I be able to breed?"
Viper narrowed his eyes and grinned.
"Right now if you want to..."
Ci-kat-a lifted from the vine stretcher and stood on the ground on all fours,
raising his wings. He extended and lowered his ovipositor, which shuddered a
little and then a white ellipsoidal form the size of a basketball slowly
squeezed through the opening. He lowered the ovipositor a little more so
that the egg contacted the floor. The egg came out with a bunch of a translucent,
sticky slime, which steadied the egg on the ground.
"Aw, damn, did you have to do that *here*?" - Viper moaned - "Thisss is
*really* gonna ruin my decoration..."
"It hurts a bit... It's strange... The feeling of generating a new life... It
gives you a feeling of power... As if you were a *god* or something..."
"Uh-ho!" - Viper thought - "Thisss is not a good ssstart... If he ssstarts
thinking he's divine, then we're really in big trouble... Guesssssss I'll
have to kill him sssooner than I thought... But only *after* he has dessstroyed
the SSSWAT Kats..."
"Thank you, Viper! I won't forget what you did for me... You can keep the egg.
I'll have to find a new hive for my brood now!"
Then, the bug-kat went out of Viper's lab.
Viper's eyes glowed and a sinister grin appeared in his snout.
"I know you won't forget what I did for you... My... sssurgery... will take
care of that..."
He then stared at the whitish ellipsoid surrounded by a pool of slime in the
middle of the room.
"If only it didn't have all this sssticky, sssmelly *goo*..." - he began
salivating - "Well, guessss I can make a big omelet with it..."
----------------------------------------------------------------------------------
Callie got up early as she always did on Mondays. She could imagine the amount
of paperwork she would have on top of her desk right now. Mondays and Fridays,
those were her nemesis.
She yawned as she stepped inside the lift. It was so early that even the
cleaning crew hadn't departed yet. The elevator took her to the last floor,
where her and Manx offices were. When she stepped out of the lift several
whitish soft ellipsoids tumbled to her feet. She made a disgusted face as the
translucent slime dropped on her feet.
"Eeew! What *is* this thing?"
She covered her nose with her paw as the pungent odor of the slime filled
the tiny space of the elevator. She left the elevator and gasped in horror.
The entire floor of the corridor was filled with those soft things. And, the
smell was unbearable. Fighting her disgust, she made her way through the
whitish objects and went up to the roof.
She opened the door to the clock house and gasped as a small avalanche of
those whitish things fell over her, dragging her as it rushed downstairs.
Her clothes were all covered with sticky slime.
"This is *gross*! Yach! What *are* these things anyway? They remind me of..."
A chill ran down her spine.
They reminded her of insect's eggs!
She forced herself to take a closer look. She touched one egg. It was soft and
cold. She could see something moving inside. She peered closer. The eggshell
was whitish but somewhat translucent. The thing inside was bent over itself
and seemed to have a purple color.
Then, it suddenly looked directly at her with its big red multifaceted eyes.
She pulled her head back, frightened, and dropped the egg.
The egg began trembling. It suddenly lost its whitish color. It was now
transparent. The bug inside started squirming and biting the eggshell. All
around her, several other eggs lost their color too and the insects inside
were squirming and eating the eggshell.
Callie turned on her heel and ran downstairs, knocking and tumbling the
eggs in her way. She reached the elevator and slammed the button. Fortunately,
no one had called it and it was still up there. She ran inside and slammed her
finger on the 'down' button.
She was quivering from head to toe. The translucent smelly goo ran down her
features and her clothes. When she recovered enough from her shock, she reached
inside her purse and retrieved a white triangular object with a red circle in
the center. She pressed the button in the center with such force it seemed her
finger would be stuck on it.
-----------------------------------------------------------------------------------
Jake and Chance were repairing the TurboKat when the klaxon and the red light
beside it filled the hangar with fiery red blasts and loud honking sounds.
"Action, finally!" - Chance said as he ran to pick up the receiver.
- "Yes, Miss Briggs!"
"Chance, am I glad to hear you..." - she said with an urgent but relieved
tone in her voice. She suddenly covered her mouth with her paw.
"I'm sorry, I forgot I shouldn't use your real names!"
"Never mind that, Callie! What's happening? You seem startled!"
- he asked, concerned.
"We have a little bug problem at City Hall, guys. It's the ci-kat-a!
It's back!"
"WHAT? But, I thought we squished that termite!" - he said, his own
voice shuddering a little.
"All I know is that the upper floors of City Hall are infested with these
hideous eggs... Oh! Oh, no! It's getting out! AAAAAAAAAAHHHH!"
"CALLIE! CALLIE, ARE YOU THERE?"
Nothing. The receiver went blank after a few moments of static. Jake ran to his
side with an inquiring and worried gaze.
"What happened? Is Callie in trouble?"
"I think so, buddy! I never heard her so frightened! It's that ci-kat-a
again!" - Chance said as he put the receiver back on the hook.
Both kats ran to their lockers.
"I thought we finished it off!" - Jake said as he put on his G-suit.
"Jake, I think you'd better stay here and finish with the TurboKat!"
"No way! I'm goin' with you!"
Chance stopped him.
"Jake, think! We might need the TurboKat ready! Of us both you're the one
more qualified for that job!"
"But, Callie..."
Chance grabbed Jake's shoulder and squeezed it a bit.
"Don't worry! I'll save her! I *promise*!" - Chance said reassuringly.
Jake seemed to power down a little.
"What about you? Are you sure you can handle that bug?" - he asked, remembering
Chance's entomophobia.
"I'm not afraid of bugs anymore! I thought I made that perfectly clear
already!"
"Okay..." - Jake reluctantly said - "But, maintain radio contact at all times,
do you hear? Leave the frequency open!"
"Affirmative!" - T-Bone said as he put on his helmet and clicked on its side
to activate the radio.
He ran to the Cyclotron and left the hangar. Razor activated his radio too
and tested it.
"T-Bone, do you copy?"
"Loud and clear!"
"Okay, Razor out!" - he closed his eyes and thought to himself - "Save her,
T-Bone... Please, save her..."
-----------------------------------------------------------------------------------
T-Bone drove the Cyclotron toward Megakat City. He was sunk in his own
thoughts.
"Cru-ud! Why did they have to be bugs again? I'm not so scared of bugs like
I used to be but still... Crud, this is *not* my idea of fun!"
He joined the morning traffic of Megakat City. Fortunately, it was early and
the traffic wasn't dense yet. He managed to reach City Hall in a few minutes.
The few workers that were already in there watched in astonishment as T-Bone
burst through the front doors and drove the Cyclotron inside the building and
upstairs. He stopped the Cyclotron when he reached the last floor. Besides some
smelly translucent ooze on the carpet, there was nothing there.
"T-Bone, what's going on?" - his radio crackled.
"I'm on the top floor heading for the clock tower. So far so good, but there's
still no sign of Callie."
"Roger. Be careful! Razor out."
"Ain't I always?" - he muttered and grinned.
The smell was getting stronger. He left the Cyclotron and slid his glovatrix
on his right arm. He leaned against the wall when he reached the corner and
peered. Nothing. The corridors were empty.
But, the smell remained. Stinky. Like rotten flesh.
He headed for the clock house. The stench was getting stronger by the moment.
He opened the door and gasped at what he saw.
A hive. Filled with dozens and dozens of eggs. And, a few purple bugs, flying
around with their red wings.
"What is it?" - Razor's voice came from the radio. He had heard T-Bone's gasp.
"It's... It's a hive..." - he whispered - "I'll try to sneak in!"
"Be careful!"
"I heard that the first time, okay?"
T-Bone closed the door and hid behind a structure similar to a honeycomb.
There was one egg inside each hole.
Then, he saw her. A chill ran down his spine when he saw Callie stuck to
another honeycomb with a sticky yellow slime. She seemed unconscious but
unharmed.
T-Bone scanned the hive. He hadn't located the big bug yet.
"That's odd... With so many eggs, the progenitor shouldn't be far away!"
- he mumbled.
He tried to count the flying bugs. Nine, it seemed. He knew those bugs could
put up a good fight. And, he didn't want to get bitten by any of them.
"Guess my only choice is to snipe 'em," - he thought.
He aimed his glovatrix carefully. From his standpoint, he could only get a
clear shot when the bugs weren't moving.
"There you go, baby! Just like shooting ducks in a carnival..."
He fired a Mini Turbo-Blade which beheaded the little ci-kat-a. The bug fell
limply to the ground with a low thud.
"Gotcha... One down, eight to go..."
He managed to shoot down five more ci-kat-as before he was spotted.
"CRUD!"
The purple bugs plummeted down on him. He left his hiding place and jumped
forward, rolling on his back and standing to his feet. The ci-kat-as didn't
maneuver rapidly enough and smacked against the honeycomb.
T-Bone fired three Mini Spider Missiles, which wrapped two of the ci-kat-as in
their threads. The third bug flew towards him and tackled him, knocking the big
tabby to the ground. The bug tried to bite him. His black mouth parts snapped
wildly near T-Bone's neck. He managed to keep them away from him.
"Chew on this, slime ball!"
He fired a Mini Turboblade directly into the mouth of the ci-kat-a. The sharp
piece of metal ripped the bug's head and left by the back of its skull. The
dying bug let out a volley of yellow ooze over T-Bone's face. He tossed the
bug away and quickly wiped the sticky, smelly slime off his face.
"Dirt bag! Crud, this *stinks*!" - T-Bone said, grimacing in disgust.
"T-Bone, come in! Do you copy? T-Bone!"
"I'm here, Razor. Everything's fine. I've spotted Callie and I'm taking
her out of here."
"How is she, pal?"
"She's fine!" - he went to the honeycomb where Callie stood - "I hope!"
- he muttered.
He climbed up the honeycomb and took away part of the yellow mucus. She fell a
little and he grabbed her, jumping to the ground.
"Now, let's clean this crud from City Hall! Deploy Mini Match-Head Missiles!"
The missiles set the hive on fire. T-Bone got out of the clock tower and ran
downstairs, towards the Cyclotron. Callie was regaining consciousness.
"Wha... What happened? Where am I?" - she babbled.
"You're safe now, Miss Briggs."
"T-Bone? The bugs... They're..."
"Everything's okay, Miss Briggs." - he slammed his fist on the fire alarm and
the bells started ringing all over the building.
"Where's the fire?" - she asked. She had a confused look on her face.
"Right above us!"
Just when he finished the sentence, there was a blast.
"CRUD! Guess that slime was explosive too!"
A rush of fire was descending after them, burning everything it touched.
He slipped onto the Cyclotron and motioned Callie to sit in front of him.
"Keep your head down, Miss Briggs! We're gonna use the emergency exit!"
He started the Cyclotron and rushed towards the window at the end of the
corridor. The wall of fire was just behind them.
"What emergency exit? No! You don't mean..."
She ducked her head and he leaned his torso over her back. He ducked his
head too when they crashed through the window and began falling from the top
floor of City Hall.
"Emergency thrusters... ON!"
He slammed his hand on a button and the thrusters roared to life, boosting
the Cyclotron over the void between City Hall and the neighboring building.
The roaring blast of fire rushed over T-Bone's back but only slightly burned
his G-suit.
The Cyclotron landed on the roof of a nearby building with its rear wheel.
T-Bone controlled the red transport and halted it. He raised his torso and
peered down to Callie.
"Miss Briggs, are you okay?"
She got up and looked behind. She nodded her head yes. They both looked back
at City Hall. The clock tower was on fire, but the firekats were already on
their way.
"I hope we've seen the last of those bugs!" - she said as she climbed out
of the Cyclotron - "Oh, this is disgusting! My clothes are all *gooey*! Yach!"
"YOU DID THIS TO MY HIVE, SWAT KAT! NOW, YOU MUST PAY FOR IT WITH
YOUR LIFE!"
- a voice buzzed from above them.
A dark orange form fell on top of T-Bone, knocking him to the roof.
T-Bone hit the roof on his face.
Callie stepped away a little bit.
Ci-kat-a grabbed T-Bone by his shoulder harness and tossed him against a
ventilation unit.
The big tabby collapsed to the ground, where he stood on all fours, shaking his
head. He looked up and a thin thread of blood dripped from his nostrils. He
licked the red fluid from his upper lip and spat it.
"So, the big bug can talk too!" - he said as he stood to his feet - "That's a
new development! And, I thought ci-kat-as only came in purple..."
"I was Dr. Harley Street, but now you can call me Ci-kat-a!"
He lunged at T-Bone but the kat dodged the bug-kat and smashed his fists on
Ci-kat-a's back, making him crash to the floor.
"Dr. Bug-Eyes! Now *that's* a surprise! I thought we'd finished you off
years ago!" - he teased the mutated kat as the other threw him a punch, which
the big tabby blocked perfectly.
He punched Ci-kat-a in the face, but the bug-kat jumped on top of T-Bone,
knocking him to the ground.
"Just one bite and you'll be on my side, helping me to conquer this puny
world!" - Ci-kat-a said as his black mouth parts drew closer to T-Bone's neck.
"Bite the floor, you sicko!"
The strength of the mutated kat was considerable, but T-Bone was more agile. He
placed one foot in Ci-kat-a's gut and tossed him over his head. The bug-kat
smashed to the ground behind the big tabby.
"You heard that, Razor? Dr. Bug-Eyes is back!"
"Give him a punch for me, will you, buddy!" - Razor's voice came from the radio.
"My pleasure!" - he purred.
Ci-kat-ta got to his feet and flew over T-Bone, spitting some yellow slime
over him.
T-Bone just barely dodged the first volley when he was hit in the chest by
a second one.
"Ah, *nuts*! I just washed the suit! Eat this!"
T-Bone fired a Mini Octopus Missile that clamped Ci-kat-a's jaws together. However,
he tore it apart just by opening his mouth parts. He spat some more ooze,
but T-Bone escaped from the shots.
The bug-kat plummeted down on him and punched him in the face, making the
big kat fall to the ground. He then landed on top of T-Bone and vomited a
large quantity of slime, almost encapsulating the big tabby inside. The
slime slowed down his movements. The more he fought it, the more it stuck
to his body. Ci-kat-a slowly leaned over T-Bone, ready to bite him.
The big kat was defenseless.
The wicked jaws got closer and closer to his neck.
He could feel the stinking breath of the mutated kat slightly waving his
neck's fur.
He fought with all his strength but only got even more entangled in the
sticky slime.
But then, something happened.
Ci-kat-a arched his back and braced his abdomen, screeching out loud. He
stepped back from T-Bone, still embracing himself and screaming in pain.
He fell to his knees.
Callie ran to the big tabby and helped removed the yellow crud from him.
"What's got into him?" - she asked in shock.
"Beats me, but I'm gonna get rid of him right now!" - T-Bone said as he
rose from the ground and ran towards the bug-kat.
Ci-kat-a saw the SWAT Kat running to him. He knew he couldn't fight him with
that pain inside him. He had to get away. Away from there. Away from him.
"Viper... I don't know how, but I'm sure you're behind this..." - he mumbled.
He extended his membranous wings and flew off the building.
"CRUD! You won't get away from me that easy!"
T-Bone threw a tiny tracking device that attached to Ci-kat-a's fur. He
climbed up the Cyclotron and jumped from building to building until he
hit the ground level.
"Razor, you have him?"
"Affirmative! Signal's coming in strong, T-Bone!"
"Good! Don't lose him! I think I may have a few problems; it's rush hour."
"Don't worry. Hey! That's odd!"
"What's up?
"He seems to be heading for... Megakat Swamp?" - Razor said. Even over
the radio his voice seemed puzzled.
"The swamps? Shouldn't he be heading for the MASA Space Center or the
nuclear plant or something?"
"No... He's definitely going for the swamps..."
"Okay, buddy. I'm on my way."
A few seconds passed before Razor spoke again.
"T-Bone, how's Callie?" - he asked sheepishly.
"She's fine, buddy, don't worry! Hey, I told you I'd save her, didn't I?"
------------------------------------------------------------------------------------------
"Aaahh! Sssequencing DNA is one of the sssimple pleasuresss in life..."
- Viper sighed happily as he prepared a gel electrophoresis for the DNA
sample he had retrieved from the agrecite scorpion.
"VIPER!" - Ci-kat-a roared as he burst inside Viper's lab.
In his right paw there was a sap slinger hanging limply and slobbering
green acidic sap onto the ground.
Viper turned to see his dead plantimal hanging in the paw of the bug-kat.
His eyes glowed bright golden as a grin appeared on his snout.
"Ssso... You're back! What do you want from me thisss time?"
"You slimy piece of crud! You know *exactly* why I'm here!" - he said as
he tossed the plantimal against the wall, squashing it and leaving a green
burst of sap on the dull wall.
"You really should ssstop messsssssing around with my decoration, you know?"
Ci-kat-a leapt into the air and lunged towards Viper.
The green kat promptly snaked his tail around the bug-kat's neck, tightening
the grip. The bug-kat tried to bite Viper's tail, but the good doctor wasn't a
fool. He knew Ci-kat-a's jaws couldn't bite him the way he had grabbed the bug-kat.
"Now, if we jussst calm down a little bit maybe we can sssettle thisss, *okay*?"
Viper tightened his grip around Ci-kat-a's throat even more. The bug-kat
couldn't do much more than buzz in reply. Viper loosened the grip but kept
his tail around the bug-kat's neck.
"Okay..."
"Very well. Now, I sssuppose you're here because of a sssertain pain, aren't
you?"
Ci-kat-a began squirming furiously again and spat some yellow slime toward
Viper's face.
The reptilian scientist tightened the grip of his tail around the bug-kat's
neck so hard he nearly broke his trachea.
Ci-kat-a calmed down again.
"Don't you *ever* do that again!" - Viper said as he swept the crud away from his
face with his paws.
"What did you do to me?"
Viper chuckled dryly. He went to the lab bench with the bug-kat still entwined
in the powerful hug of his tail and retrieved a test tube with a whitish liquid
in it. He showed it to the bug-kat.
"Know what thisss isss? It'sss sssomething you lack in your syssstem. You
sssee, when I was operating on you I couldn't help to make a few... modificationsss...
on your genome. It'sss quite easy, really! With the proper mutagenic chemicals, I
made your DNA mutate and ssso, your cellsss can't produssse the aminoasssid
methyonine anymore."
He placed the test tube on its support again. Then, he turned his gaze to
Ci-kat-a.
"Unlesssss you're completely sssupplied with methyonine by me, you'll sssoon
ssslip into a coma and die."
"Why did you betray me?"
"Weren't you planning to do the sssame with me?"
Ci-kat-a didn't answer. Viper grinned. He was still the same Harley Street
that Purvis had known from their university days.
"I need that thing! I feel like I'm falling apart!" - Ci-kat-a asked.
Viper just gave a little dry chuckle as he retrieved the test tube again.
"That'sss one of the symptomsss, alright! Here, drink thisss. It will enter
into your sssystem as soon as your digessstive tract begins absssorbing it,
which should happen in a few minutessss."
Viper released Ci-kat-a and handed him the test tube. The bug-kat grabbed it
and awkwardly drank the whitish liquid.
"So, I guess now I'm under your control, huh?" - Ci-kat-a sighed resignedly
- "What do you want from me?"
"I want to mutate you! You're already part ssspace insssect. With my
mutationsss, I can turn you into an unssstoppable weapon! Imagine what I could
accomplish with a ssservant who could reprodussse like you can!" - he said, eyes
glowing, tail slashing the air crazily behind him.
"You're insane!"
"I know..."
---------------------------------------------------------------------------------------
T-Bone finally got rid of the rush hour traffic and sped up the freeway that
took him out of the city and passed near the swamps. He twitched his nose. He
smelled like rotten flesh. But, there wasn't time to think about it. He had to
find the ci-kat-a and destroy it before it could reproduce again. But then
again, the bug must be starved. So, why didn't he go to the nuclear plant to
feed on some nuclear fuel rods like his predecessor did? Why did he go to the
swamps instead? His thoughts were interrupted when Razor's voice crackled over
the radio.
"Hey partner, how's it goin'?"
"I'm on the freeway, heading for the swamps. I should get there in half an
hour!"
"Need a ride?" - the voice seemed amused.
T-Bone looked behind him. There it was, like a huge dark bird of prey.
The TurboKat.
"You fixed her already?" - he asked dumbfounded.
"Almost! She needs some more fine tuning but hey, she can fly! Get ready!
I'll pick you up in T minus five."
"Ready for pick-up in three... two... one..."
The TurboKat made a grazing pass over the red transport and picked it up in
its cargo bay. T-Bone appeared in the unfamiliar rear seat of the black jet.
Razor flew the jet fighter up and towards the swamps.
"Nice catch, Razor!" - T-Bone said as he strapped in.
"You're not the only one who's been spying around, you know?" - Razor said
with a smirk on his muzzle.
"Why you little... Okay, I guess it's fair..."
"You got him on radar?"
T-Bone didn't answer immediately. It took him a bit to familiarize himself with
the instruments in front of him.
"Got it! His signal's comin' due... southwest. Right in the middle of the
swamps!"
"Next stop... Megakat Swamp." - Razor said as he pushed the throttle switch
forward. He twitched his nose and grimaced in disgust.
"What *is* that smell?"
"Don't ask..."
"Pee-yew! Buddy, you *stink*!"
"Tell me somethin' I don't already know! Yach! I'm all *slimy*!"
"Aw, crud... I just cleaned the cabin..."
------------------------------------------------------------------------------
"How are you feeling now?" - Viper asked the bug-kat.
He was surprised that Ci-kat-a accepted his servant condition so promptly,
without ever arguing or trying to bite him or kill him. The bug-kat's
attitude made him cautious. But, on the other paw, he knew Ci-kat-a couldn't
survive without him.
"Much better. That pain was awful, Viper! It was as if my body was slowly
disintegrating!"
"You manage to do a correct dessscription of what wasss actually happening
inside your body without having the proper knowledge for it... It'sss amazing!
Yesss, your body *wasss* disssintegrating. Without that aminoasssid, your
cellssss can't produce proteinsss, which are the building blocksss of your
body..."
"So I really *was* coming apart!"
"Quite literally... Wait a minute... What'sss thissssssss?"
Viper took out a little, round-shaped white device from the fur on Ci-kat-a's
back. There were two initials on it.
"S K? YOU FOOL! YOU LED THE SSSWAT KATSSS RIGHT TO MY LAB!" - Viper
shouted as
he threw the tiny device on the floor and crushed it with his foot. He calmed
down a little bit, forcing himself to think rationally.
"Well, let them come. When they arrive here, they will have a little
sssurprise! We'll crush them like *flyessssss*! Hum, no offenssse..."
---------------------------------------------------------------------------------------
"Kat Tracker's got him!" - Razor said as he inspected the triangular display
on his glovatrix - "Dr. Bug-Eyes should be dead ahead!"
"I just hope we don't tumble with Dr. Viper... We're on his ground now..."
- T-Bone said as he walked through the swamp near the marshes.
"Hey! Where did he go?" - Razor asked to himself.
"What's up?"
"I lost him!"
"He must have found the beacon... WHOA!"
T-Bone slipped on something and plunged in the muddy water. He promptly burst
up, gasping for air and started floating.
"'Re you okay?" - Razor asked as he swam towards the big tabby.
"I'm fine! You already taught me to swim, remember?" - T-Bone said as he swam
towards Razor.
"Juuust checking! Now, let's see..."
Razor turned his gaze to the display again.
"Yes, this was his last location... That's strange - it's only fifteen meters
away, but there's nothing there unless that big... mangrove... tree..."
Razor looked up and then he saw it.
"Viper's lab!" - both kats said simultaneously.
They swam to the big mutated tree and climbed it up. They spotted the entrance
and blasted it with a double kick. They broke into the lab with their glovatrixes
ready.
The lab was immersed in a natural semi-obscurity. When their eyes accustomed to
the difference of light, they checked the room. It was big, with rude lab benches
made out of vines. The shelves on the rough, dull green and brown walls were also
crude and knotty.
But, something was wrong.
It wasn't the obscurity. Rather it was the sepulchral silence.
"They're empty..." - T-Bone whispered.
Razor frowned.
"What's empty?" - he replied in the same tone, not taking his eyes from the
room.
T-Bone tensed his muscles. His eyes swung from one side of the room to the
other.
"Everything. There's nothing on the tables. There's nothing on the shelves.
You'd think a lab would be stuffed with glasses and gizmos, wouldn't you? This
means..."
"They're expecting us!" - Razor completed as he tensed his muscles too.
"Right you are, SWAT Kats!"
Ci-kat-a pushed both SWAT Kats from behind. They fell on the ground and rolled
onto their backs, regaining their feet.
"Stop right there!" - Razor said as he trained his glovatrix on Ci-kat-a.
A whooshing sound came from his left. Something scaly snapped him in the
side of his torso and made him fall over T-Bone. The pain was sharp, as
if he had been whipped. He looked to his left and saw two glowing, yellow
eyes. Razor narrowed his.
"Viper! I knew I should have killed you when I had the chance!"
He scrambled to his feet again. They were surrounded. The lights were turned
on, blinding them for moments. T-Bone kept his glovatrix aimed at Ci-kat-a
while Razor aimed at Viper. They were back to back. There was no room to fight
and even less to escape.
"You get Viper, I'll handle the bug!" - T-Bone whispered - "On the count of
three we attack! One... Two... THREE!
Razor lunged over Viper, knocking him to the ground. He punched the green kat's
face.
Viper, however, managed to unsheathe his claws and swished them on Razor's
right arm but only ripped his sleeve. Razor got up with a back flip.
T-Bone somersaulted forward and extended his right leg while in the air,
hitting Ci-kat-a in the head. The bug-kat ducked to the ground with the
blow. T-Bone lifted his left leg and tried to stomp on the bug-kat's head,
but Ci-kat-a rolled away and he missed.
Ci-kat-a got up to his feet and regrouped with Viper. The SWAT Kats did the
same.
"Now! Use it!" - Viper ordered.
Ci-kat-a's antennae started quivering and from all around the SWAT Kats
thousands of insects, from beetles to roaches, appeared almost out of nowhere.
"What the..." - T-Bone said in a weak and shaky voice.
"HAH! It won't be a few bugs that'll stop me!" Razor jumped over the bugs and punched
Ci-kat-a.
The bug-kat lost his concentration and the bugs became confused.
Viper intervened and snaked his tail around Razor's neck, lifting him from the
ground and smashing him against the wall. Ci-kat-a recovered enough to control the bugs
again.
Razor dug his claws into Viper's tail, but the green kat just tightened the
grip even more. Soon, Razor was having trouble breathing.
T-Bone moved back a few steps, but the bugs kept coming towards him. They
started crawling up his legs. The big tabby quivered visibly. His eyes were
wide open, as was his mouth. His breath came in gasps.
The bugs kept crawling up his legs and onto his torso. Thousands of them
were literally covering T-Bone's body.
His breathing came in shorter and more frequent gasps. His heartbeat was
very accelerated. He was panicking. His mind was blocked. His eyes were
glazed.
The bugs kept coming. They were on his chest now and covering his arms.
T-Bone's mind flashed, flying back to when he was a teenaged kitten. He saw
a dark form near him. Then, the flash ceased.
Razor looked at his partner. He was locked in Viper's lethal grip and could
do nothing to help his friend.
Another flash. This time he felt something raspy scrubbing the curve of his
neck and shoulder. Then, it was over again. He shivered. The panic overwhelmed
his mind.
"NOOOOO!" - he screamed out at the top of his lungs, placing his paws
on his head.
T-Bone knelt to the ground with his eyes tightly shut.
A primal fear overwhelmed the big tabby, a fear he couldn't understand nor
control.
"NO! MAKE IT STOP! PLEASE, MAKE IT STOP! AAAAAAAAAAAHHHHHHHH!"
He slumped to the ground in fetal position, screaming in what appeared to be
pain.
Ci-kat-a called back the bugs, but T-Bone still lay on the ground, rocking
from side to side, babbling softly and crying.
"I don't wan' it! I don't wan' it! Please stop it! I don't wan' it!
I don't wan' it!"
Razor was astonished! He knew his buddy was an entomophobe, but he never expected
that he would react that way. Now, as he was lying on the ground rocking from
side to side and stammering the same thing again and again, he seemed as
defenseless as a newborn kitten.
In fact, he seemed insane! Could it be that T-Bone's mind couldn't cope with
the fact he was being attacked by thousands of bugs and simply crossed the thin
and blurred line that separates a normal mind from complete madness?
There he was. The big tabby, the powerful T-Bone, the all-around
Chance Furlong... Lying in the floor... Crying like a baby...
Fear can change one during a moment, but panic can destroy one's soul
forever. And in that moment, T-Bone was defeated, destroyed, finished...
"Take thisss piessse of crud out of my sssight. Lock him in the other room."
- Viper ordered Ci-kat-a.
Razor squirmed, trying to get rid of Viper's hug. But, it was hopeless.
Viper brought Razor closer to his face. He brought him so close that
their noses were almost touching each other.
"As for you, SSSWAT Kat, I'll make your demise *very* painful and *exssstremely*
long!"
Viper narrowed his eyes and grinned, sibilating.
"I haven't forget our lassst encounter. I asssked for your help, but you left
me there to die. Ssso now, you mussst sssuffer for your actionsssssssss!"
Viper chuckled dryly and slammed Razor's head against the wall. The last
image Razor saw before his world turned black was the evil grin of Dr. Viper.
-------------------------------------------------------------------------------------
Razor woke up in a darkened, featureless room. He blinked and tried to get his
bearings but, besides the living wall around him, there was nothing identifiable.
Or was there?
He thought he had heard something. Breathing. Someone was there with him.
"T-Bone? Is that you?" - he asked, but his voice was groggy and his throat
ached.
"I'm here, buddy..." - T-Bone's voice came to him, tired and mournful.
"Where are you? I can't see you! It's too dark!"
Razor tried to raise himself from the ground but something stopped him. Only then
did he notice that he was tied up.
"How are you doin', pal?" - he asked, remembering T-Bone's condition sometime
ago.
"Better... Given the circumstances."
"What happened back there?"
"I'd rather not to talk about that, if you don't mind..." T-Bone closed his eyes
and dropped his head to his chest in the dark. He didn't want to think about it.
He didn't want to *remember* it!
He wanted to sweep that from his life. But, despite his best efforts, it would
always come back to his mind, ready to torment him.
Ghosts from the past haunting the present.
Suddenly, the room was invaded by a faint light.
"Aahh, I sssee you woke up already."
Viper let the door open so that some light could enter the room.
The big tabby moaned softly as his eyes were adjusting to the new light
conditions. Razor looked back and saw him. He gasped.
T-Bone was imprisoned high against the wall, arms and legs spread in 'X'. His
shackles were nothing but living portions protruding from the wall, gripping
his wrists and ankles tightly.
"T-Bone..." - Razor said in a weak voice. Then, he turned to Viper, rage
burning inside his chest.
"What did you do to him?" - he asked through clenched teeth.
Viper just laughed dryly.
"Don't worry about *him*! It'sss *yourssself* you should be worried
about! I'm going to finish you off from all sssides! Firssst, I'm going to
ruin your image in Megakat City. Then, I'll torture you ssso much that
you'll be even more insssane than I am when I'm finished with you. Finally,
I'll mutilate you and *eat* you piessse by piessse while you're ssstill
alive! I'll drink from your blood and feassst on your flesh while I delight
myssself hearing your deliriousss and bloodcurdling cries of pain and your
implorationssss for mersssy!"
Viper sibilated loudly as his eyes acquired an intense yellowish glow.
Razor gulped. He knew Viper was insane and hated him enough to do just
what he said. But, he wouldn't give up right now.
"What about T-Bone? What do you intend to do with him?"
"That will come in itsss time. Right now, you'll be doing all my dirty
work! For startersss, I want you to rape Megakat Biochemical Labsss of
all the chemicalsss I require!"
"And, if I refuse?" - Razor asked defiantly.
"I was *really* needing a ssstrong and healthy lab rat for my
experimentsssss..." - he said thoughtfully, rubbing his chin - "Your partner fulfillsss
both my requirementssssss..."
Razor dropped his head. He couldn't put T-Bone's life at stake because of him.
"Well, SSSWAT Kat? What'sss it gonna be?"
"Can I talk to my partner alone for a few minutes?"
"Permission granted. You have three minutessss," - Viper said after thinking
a bit. He left and closed the organic door.
"What do I do, buddy? Give me some advice, 'cause I dunno what to do now!" -
Razor asked, eyes abated..
"Run away! Accept Viper's task and then run away! Save yourself!" - T-Bone
answered intensely.
"But, he'll experiment on you! I can't bear to think of that!"
"Don't worry about me! Save your tail!"
"I can't... I can't leave you behind! You'll suffer a thousand deaths at
Viper's paws! I couldn't bear to carry that burden on my back the rest
of my life!"
"I'm relieving you of that burden! *Get*...*the*...*heck*...*outta*...*here*!"
Razor closed his eyes and dropped some tears. It was happening. His nightmare.
T-Bone could die because of him. He was putting T-Bone's life in jeopardy!
"What do I do?" - he thought - "If I escape, T-Bone gets mutated! If I accept
Viper's task and if something doesn't please him, he could mutate T-Bone just
to punish me! What do I do? What do I do?"
"Time'sss up! Conversssation endsss now!" - Viper shot as he opened the door.
Razor closed his eyes, both to protect them from the luminosity from
outside and as a sign of resigned defeat.
"Well, what did you dessside?"
"I'll do it, Viper... I'll rob the Labs for you..." - he sighed.
"I knew you wouldn't defy me!" - Viper went inside and snapped the ropes with
his claws - "Come with me."
"What about T-Bone?"
"He's not going anywhere."
They left the room and closed the living door again. T-Bone stood there in the
darkness. He dropped his head to his chest.
"Jake, get the heck outta here!" - he thought - "Don't mind about me - just save
your tail! Don't let the name of the SWAT Kats be dragged on the mud."
----------------------------------------------------------------------------------------
"Commander, the tapes got something!"
Feral followed one of his Enforcers to a viewing room in M. B. Labs. The lab
had been robbed the previous night and several chemicals were missing. Feral
didn't need to view any security tape to know that Viper would be behind it.
They entered the viewing room.
"Commander, you won't believe this. Camera 13 caught some great shots of the
robber!" - one of the night watchers said as he stepped aside and played the
video.
Feral opened his mouth when he looked to the black and white monitor. A slim
form dressed in a G-suit was stealing the lab. The kat was intentionally looking
for some chemicals and, when he'd found them, he'd put them in his backpack. Then,
he looked directly at the camera. His mask and his features became clearly
visible.
The night watcher froze the picture.
"Clawson!" - Feral thought - "But why?"
He inspected the monitor. Razor's face seemed strange. Almost as if he was
regretting what he was doing.
"Well, Commander, seems like we have our kat!"
Feral closed his eyes and sighed. What the heck was going on? Did Conway
and Hackle screw something up?
"Commander?"
Feral had no choice. The evidence was there, right in front of him. Razor's
face was unmistakable as was his outfit, even in B&W. He opened his eyes and
left the room, heading downstairs to Sergeant Reeves, who was talking to
Felina.
"Sergeant, put out an APB on the SWAT Kats. If they set one claw in this town,
I want them brought in," - he said mechanically, surely an effect of the
years of training.
"Yes, Sir!" - Reeves said, saluting his commander and leaving.
"Uncle, what's happening?"
Feral took Felina aside, so they could talk in some privacy.
"What's up, uncle? Why do you want to arrest the SWAT Kats this time?"
"Clawson did it! He robbed the Labs!"
"*What*?"
"I'm not making it up! Security cameras got him in action! He was stealing
the chemicals! I saw it with my own eyes! I couldn't believe it too, but
cameras don't lie!"
"It can't be..." - she murmured in shock.
Feral simply shook his head.
"Though painful it is to admit that my own son and his friend are criminals,
the SWAT Kats robbed this lab and it's our duty to arrest them, Felina. And,
that's exactly what we're gonna do!"
---------------------------------------------------------------------------------------------
"Today's news. Megakat Biochemical Labs has been robbed and Megakat City
Enforcers are already chasing the criminals. Commander Ulysses Feral had
this to say."
The small picture in the right upper corner enlarged until it covered the
entire screen. Amid tens of reporters and with his fur glistening because
of the flashes from the cameras, Feral spoke.
"The security video cameras inside the Labs caught good shots of the
perpetrator. SWAT Kats, wherever you are, you'd better turn yourselves
in. No further comments, please."
Viper turned off the small TV set and grinned.
Ci-kat-a came to him. "You seem pleased. Bzzz-zzz!"
"I am. Finally, I'm dessstroying my enemiesssssss. Yesssssss, Ci-kat-a.
Revenge is ssssssweet. I guess it'sss time for another dose of methionine,
isssn't it?"
Viper turned away to the lab bench to prepare some concentrated methionine.
The bug-kat stayed behind, sunk in his own thoughts.
"Yes, it is, Viper... Revenge is sweet... And, it should be well savored..."
-------------------------------------------------------------------------------------------
"You did *what*?" - T-Bone asked in disbelief.
Razor was with him, inside the darkened room again. He lowered his ears
and hung his head, eyes shut. He had never felt so ashamed in his entire life.
"I did what Viper told me to do..." - he said in a sheepish tone.
T-Bone rolled his eyes.
"Didn't I tell you to *run away*? Now were *both* Viper's prisoners *and*
pursued outlaws!"
Razor knelt before T-Bone and dropped his head to his chest, arching his
back forward, staring at the ground.
"I'm... I'm sorry, buddy... I... I just... I just didn't want to be alone
again..."
That comment struck T-Bone like a punch in his gut. He did it for *him*!
Razor robbed the Labs because he *cared* for his well-being! He sadly
shook his head. Wouldn't he do the same for Razor? Of course he would.
"But you're not alone, Razor! You have a family... Friends... People that
rely on you... You've got... Callie..." - T-Bone said in a soothing tone.
"But ,I wouldn't have you..."
Razor got to his feet and went to T-Bone. He meant to lay a paw on his
shoulder but the big tabby was too high for him to reach. He just laid
a paw on his chest, such a light touch T-Bone hardly sensed it.
T-Bone felt the urge again. The urge to protect Razor from everything bad in
this world. The urge to protect his little brother...
"We'll get through this..." - Razor said - "Together... As we always do..."
-------------------------------------------------------------------------------------------
"It'sss done. Here. Drink up!"
Viper handed the test tube with the concentrated methionine.
Ci-kat-a took it in his shaking paws. He stared at the whitish liquid. If
he could do any expression, he would have grinned. The bug-kat threw the test
tube against a wall. The glass container shattered and the liquid spread over
the dull brown and green wall.
"What wasss *that* for?" - Viper hissed. He sensed something was wrong.
"Fool! Did you think you could *really* control me? Thanks to your operation
I can now finish my metamorphosis! I'll turn into a space insect, with *their*
original genome! Your little modifications on Street's genome will cease to
exist!"
Ci-kat-a bent over himself, grabbing his abdomen. The bug-kat made a few buzzing
and shrieking sounds before roaring out loud. A crack began forming on his back
and, suddenly, the bug-kat's skin opened up in two. Stepping out of the slime
inside the empty shell, a purple bug-kat with red multifaceted eyes and red membranous
wings shrieked out loud.
The transformation was complete. Dr. Harley Street completely ceased to
exist. In his place stood a true alien bug, a true ci-kat-a.
Viper gasped as he watched the transformation. What an amazing specimen! Now,
all he had to do was capture it again. And then, he would study it again and
then he would control it again and then he would mutate it again and...
The ci-kat-a leapt towards Viper, tackling him to the opposite wall. The thump
drew all the air out of Viper's lungs. The space bug grabbed him by his tail and
threw him over the lab bench, causing him to shatter everything that was on it.
Viper rolled over the table and tumbled down onto the ground. Test tubes and
Erlenmeyer beakers crashed and spilt their contents all around him. He stood
on all fours.
He quivered.
It was happening again.
His reptilian instincts were overthrowing his kat condition. He grabbed his
head as his eyes glowed bright golden.
"No!" - he hissed - "I don't want to..."
But, it was too late. He looked back at the space bug. His eyes narrowed and
glowed even more. He began salivating and instinctively fully revealed his
claws. He acquired a fighting stance, with his tail raised behind him and
his upper torso bent to the ground. He sibilated and then he roared.
The ci-kat-a attacked the green kat, but Viper spun his body and slammed
his tail into the bug's side, making him crash against a shelf-covered wall,
breaking all the glass containers and spilling them all over him.
---------------------------------------------------------------------------------------
The SWAT Kats heard the first roar of Ci-kat-a when he began his metamorphosis.
Then, they heard the sound of glass breaking and, a little later, another roar.
"What the heck is happening outside?" - T-Bone asked.
"I dunno, buddy! But it sounds like a fight!"
Razor went to the organic door and placed his ear against the living door.
For a moment, he just heard more glass breaking. Then, the door blasted
inward and threw him near T-Bone.
Viper and the ci-kat-a were entwined on each other. They broke apart and
the ci-kat-a spat a volley of yellow slime towards Viper. He ducked and
lunged towards the space bug. His claws were ineffective against the
chitinous exoskeleton under the space bug's fur. He jumped back and
then snapped his tail against the ci-kat-a.
The space bug crashed against Razor, falling on top of him. The bug fell
with his belly up and strained to regain his feet. Meanwhile, Razor tried
to pull himself from under the bug. The ci-kat-a felt the strange object
squirming under him and attacked.
The ci-kat-a bit Razor in his arm. The kat let out a cry of pain and quivered
intensely for a while.
The ci-kat-a regained his stance and lunged towards Viper. They rolled out
of the room and into the laboratory again. The space bug punched Viper
in the head. The green kat lost his concentration for a while, but it was
enough for the organic shackles that kept T-Bone bound to loosen their
grip around the big tabby's wrists and heels.
He jumped away from the wall and went to Razor. The slim kat was lying on
the floor, with his face buried in the ground. T-Bone turned his friend
around and gasped when he saw him.
Razor's brain put together the thousands of images his compound eyes were
receiving and a mosaic-like image of T-Bone formed. He hissed and tried to
bite T-Bone.
"You can't escape from our master!" - Razor buzzed - "Just one bite and
you'll be on our side!"
T-Bone jumped away when Razor swished his deadly claws across his chest.
The slim kat lunged at T-Bone and pinned him to the ground. His jaws were
salivating and his razor-sharp fangs seemed to glisten in the soft light
from outside the room. He sneered and snarled, trying to bite T-Bone. The
big tabby just barely managed to keep his friend away from him.
Viper was thrown over the balcony of his tree and fell in the water. The
ci-kat-a blindly plunged down after him. Viper came to the surface in order
to breathe. He spotted the ci-kat-a a few feet away from him. He dived and
swam underwater until he saw the bulk of the space bug. Still underwater,
he snaked his tail around the ci-kat-a's neck and pulled him down while he
went to the surface and swam to the aerial roots of the huge mangrove tree
that housed his lab. The bug squirmed under the water, but Viper's grip on
his throat was tight. Soon, the ci-kat-a stopped moving. Viper let the bug
stay underwater for a while longer, just to make sure. Then, he released the
bug.
The limp form of the insect rose to the surface and slowly drifted along with
the soft current, later disappearing under the muddy waters of Megakat Swamp.
Viper climbed up the tree and stepped into his lab. He looked around and saw
it all destroyed. Then, he heard something else. Muffled sounds. Coming from
the room where the SWAT Kats were. He ran there and saw T-Bone still struggling
to release himself from Razor's attack. Viper snapped his tail against Razor,
sending him against the wall. Without a word, he ordered his living vines to
grab the slim kat and hold him tightly against the wall.
T-Bone got to his feet and stared first at Razor then at Viper.
The mutated kat was panting. The glow in his eyes faded a bit and he
blinked tiredly.
T-Bone ran to Viper.
"Viper, you gotta do something!"
"What you want me to do?" - Viper asked between pants.
"Restore Razor to his original condition! I know you can do it!"
"What makesss you think I would do sssuch thing?" - he asked disdainfully.
"You owe me one, Viper! A year ago I saved your tail! Now, all I ask is for
you to save him!"
Viper looked to T-Bone. He knew it was painful for the big tabby to see his
partner like that. The green kat closed his eyes and turned away from T-Bone.
T-Bone was desperate. Viper wasn't going to help. Razor would become a ci-kat-a
like Harley Street! No! He couldn't allow that! He tumbled to his knees. His
head hung down in humble pleading. He shut his eyes and clenched his teeth.
"Please, Viper... Help my friend... You can do whatever you want with me but
just help Razor... Please..."
Viper stopped and turned around. He was surprised to see the big tabby on his
knees, begging for him to spare Razor the torment of becoming a mutated space
bug. He walked to T-Bone and crouched in front of him.
"Why do you care about him? He'ssssss doomed and you're not! Why don't you
jussssst leave him behind!"
The big SWAT Kat looked up at Viper. A single tear dropped from T-Bone's
left eye and raced down his facial fur.
"Because he's my family... I'm sure you know how it feels when someone in
your family gets hurt... Well, it's the same thing I'm feeling now... Razor's
like a brother to me..."
A brother... A family... Those words struck Viper with the strength
of a powerful kick. Softly, he wiped the tear out of T-Bone's face.
"I'll help your friend... But, you mussst ssstay here inssstead of him. That's
my only condition. Do we have a deal?"
T-Bone shook his head yes without hesitation. Viper rose from his crouching
position and T-Bone stood to his feet again. He followed Viper outside the room and
into his lab.
"But, there'sss nothing I can do here! My lab is in piesssesssssss!"
"Then..."
"I sssaid I'd help your friend and that'sss what I'm going to do! I alwaysss
keep my promissses, SSSWAT Kat. We mussst go for the volcano in Megakat
National Park."
"To the volcano? Why?"
"You're not here to make questionsss! You're here to obey me! Did you forget
our deal?
"No... I didn't..."
"Then, let'sss go. We have a long walk ahead of usss."
"Who said we're walking?" - T-Bone smirked.
Viper just gave him an inquiring gaze.
---------------------------------------------------------------------------------------
"No wonder you defeated me ssso many timesss. Thisss jet isss amazing!"
"And, you haven't seen anything yet!" - T-Bone smirked as he landed the
TurboKat outside the dark cone-shaped mountain.
"Let'sss go. The path isss sinuousss and long," - Viper said as he jumped
out of the cockpit.
T-Bone followed in his steps.
Half an hour later, they both stood in the laboratory Dark Kat built for
Viper inside one of the lava tubes of the volcano.
Viper worked swiftly. He analyzed the blood sample he took from Razor and
isolated the mutagenic agent in the ci-kat-a's saliva that caused the
mutation. He also found some hemoglobin molecules with central ions other
than iron.
"Amazing! A mutagen *and* the neurological ssserum together! Ssso that's
how they controlled their victimsss' mindsss! Well, a dose of consssentrated
hemoglobin takesss care of the ssserum, but the mutagen can only be fought
back with anti-mutagenssss! Fortunately, Dark Kat had this lab well-equipped.
Fetch me those Erlenmeyersss, T-Bone!"
The hours elapsed. Viper worked feverishly, mixing and separating, isolating
and amplifying. T-Bone soon lost interest. His high-school basic genetics
didn't allow him to fully understand what was being done. He slumped against
the wall and fell asleep, exhausted.
Viper looked at him for a while. He felt a wave of sympathy for that kat.
It was amazing. That SWAT Kat single-handedly reached the deepest feelings
of his kat soul. He walked to him and gently shook him.
"It'sss nearly over. I'll jussst let the PCR work for a few hoursss ssso we
have enough vaccine for your friend."
"Thanks, Viper."
"Don't thank me. After all, you'll be my ssslave for the ressst of your
life..."
"Did you really mean what you said about Razor?"
"About eating him alive?" - Viper laughed dryly - "Of courssse not! You two
have been jumping around for all these yearsss! Your musssclesss musst be
rock-hard! I was planning to roassst him before eating in order to tenderize
the flesh!"
-------------------------------------------------------------------------------------------
Again in Viper's lab in the swamps, Viper stuck the needle of a syringe into
Razor's arm. The slim kat shuddered for a while and then became unconscious.
Viper released him.
T-Bone flew them all until they reached the perimeter of Megakat City. T-Bone
laid the still unconscious form of Razor on the grass of a hill.
"Come on, T-Bone! We should be heading back to the swampsssss," - Viper hissed
in an ice-cold voice.
"Can I say goodbye to him?" - T-Bone pleaded.
"Be ssswift."
T-Bone knelt beside Razor and gently squeezed the slim kat's left shoulder with
his gloved paw.
"Goodbye, Jake..." - he murmured - "Next time we see each other we'll be
fighting among ourselves. Or you won't recognize me from my mutations. Or
I may even never see you again..."
A heavy tear streaked his facial fur.
"Goodbye, little brother... I'll miss you so much..."
The big tabby got to his feet and turned around.
"Okay, Viper, let's... Viper?"
He was gone. Dr. Viper was gone!
T-Bone looked around but saw nothing. Not even the slightest shadow of Viper.
He left!
He left them there!
"Thank you, Viper..." - he thought as a few more tears raced down his face
- "Thank you for healing Razor... and for allowing me to stay with my
brother..."
Then, he heard someone mumbling behind him. It was Razor. He was waking up.
"Wha... What happened? Where am I?"
T-Bone quickly swept the wetness off his face with his arm. Then, he turned
to Razor. It was good to be back. Good to be free. Good to be with Razor again.
T-Bone told Razor what had happened. They stood there, watching the city.
"What are we gonna do now, Jake?"
"Go back to the city and clean our names. Then, we get back in the air, fighting
all the criminal scum that rear their ugly heads on Megakat City."
"And, we'll do it our way..."
------------------------------------------------------------------------------------------
------------------------------------------------------------------------------------------
EPILOGUE
»»» A few days later, in a countryside village ««««
"Mail!" - the mailkat shouted and left. An attractive middle-aged she-kat with
tanned fur and long black hair came to the mailbox and retrieved the letter.
"That's odd! It doesn't have the sender's name!"
She opened it and started to read it.
"Oh, good heavens! Mark, come here, quickly!" - she screamed.
A middle-aged tom-kat with golden fur came to her.
"What is it, Martha?"
She handed him the letter with shaky paws. He grabbed it and read it.
"For Mark, Martha and Thomas.
Dear father, dear mother, dear brother.
I'm sorry I didn't write you sooner. So many things
happened in my life that the events overwhelmed me.
I'm fine - don't worry about me. Yes, mom, I've been
eating properly and getting enough rest.
Dad, I'm doing what I like and I'm very pleased with
it. Like you told me, I chased my dream and I sort of
managed to get it.
I hope you already got your degree in Mass Communication,
little bro. 'Cause if you didn't, I'll kick your tail so
hard that you'll get it in a flash.
Hope you and Tommy are okay. I miss you all very much.
I love you all. Dad, mom, bro, you're the most important
kats in my life.
Your son and brother
Elrod Purvis"
-----------------------------------------------------------------------------------------
THE END
-----------------------------------------------------------------------------------------