Heart of a Pirate
Disclaimer: I don't own One Piece or Kingdom Hearts. They belong to Eiichiro Oda and Square Enix respectively.
Last time on Heart of a Pirate:
"In any case, Usopp," spoke up Sora before the sniper could ask what they meant. "What was the deal with you and… what was her name again?"
"Alice," Usopp supplied.
"Alice, right," Sora nodded. "How did you two know each other? For that matter, why were you dressed up like her?"
"It's… a long story," replied Usopp hesitantly.
"We've got time!" said Goofy cheerfully.
"Yeah! Come on, Usopp! Tell us! Tell us!" exclaimed Luffy, grabbing him in a headlock and giving him a noogie.
"Ow! Ow! Alright, alright!" yelled Usopp as he attempted to pry himself out of Luffy's grip. "I'll tell you! I'll tell you! Just let go of me!"
Luffy did so. Usopp coughed a bit as he massaged his head and neck, then cleared his throat and took a deep breath.
"Well, it all started when I woke up in this forest…"
Chapter 10: Usopp in Wonderland (Part 2)
Title page: Pegasus munches on Zoro's hair as he lays down doing bench presses with a large amount of weights, a surprised, angry expression on Zoro's face. Meanwhile, in the background, Hercules and Phil's silhouettes stand in a nearby archway.
Subtitle: My hair is NOT GRASS!
0o0o0o0o0o0o—Wonderland, Lotus Forest—o0o0o0o0o0o0
A Few Hours Earlier
After about an hour or so of running and screaming through the forest, Usopp's voice and energy finally began to give out, forcing him to stop and breathe. He had stopped a few times before to catch his breath, but immediately started back up again when more oddities presented themselves, including birds with pencils for heads writing on signs telling him not to step on small creatures called 'mome raths'. Only now had he finally found some respite from all the weirdness.
Right until the cat appeared.
At first, Usopp could only hear singing in the distance, but it was too soft to make anything out. It seemed to be getting closer, though, making the sharpshooter ever more nervous.
"…did gyre and gimble in the wabe…"
"Wh-wh-who's there?" Usopp called out shakily.
"…all mimsy… were the borogroves…"
"O-oi! I asked who you are! Answer me!" the sniper called again. "What do you want?!"
"…and the mome raths… outgrabe!"
The singing stopped, leaving Usopp in an eerie silence that set his nerves completely on edge. He began looking every which way, trying to spot the source of the voice before it tried to attack him.
"Lost, are you?"
Usopp whipped his head up so fast it almost cricked his neck, having heard the voice from directly above his head. There, up in the tree closest to him, was… a very wide row of teeth set in a grin, suspended in midair. Less than a moment later, the form of a large pink and purple striped cat faded in around it from nowhere, grinning like a madman.
"A… a cat?" Usopp stated in disbelief.
"A Cheshire cat, if you please," replied the cat.
Usopp jumped a bit at seeing a cat talking, but it still wasn't the craziest thing he'd seen all day. "Well, whatever! I'm just glad I finally met someone who can talk!" said the long-nose, relieved.
"And why is that?" asked the cat.
"This place makes no sense!" Usopp burst out. "Nothing I've seen follows any kind of logic! I've been trying to find my way out for the past hour or so, but I haven't found anything! Can you tell me how to get out of here?!"
"Well, that all depends," the cat said cryptically.
"On what?"
"On where you're trying to get to."
"It doesn't matter where! As long as it's outside this forest!"
"Well then, it doesn't really matter… which way you go!" the cat concluded, his all-knowing grin still present. "If you don't know where you're going, any road will take you there!"
"But it DOES matter!" Usopp exclaimed, starting to get annoyed. "I already told you, I've spent more than an hour trying to get out of this forest! And you can see how that's turned out!"
"Well, if I were to seek a way out," said the cat, continuing to lounge nonchalantly. "I'd ask the Mad Hatter… or the March Hare."
"'Mad' Hatter?" repeated Usopp, frowning. "Forget it! I've seen enough craziness already! I'm not going to go out of my way to look for someone who's mad, especially not when they have the word 'mad' in their name!"
"Oh, but we're all of us mad here," said the cat, letting out a disturbing chuckle.
"M-mad?" stammered Usopp. His annoyed manner deflated as his hope of finding a way out began to diminish rapidly. "Even you?"
"Of course," replied the cat, nonchalant as ever. "You believe a dog to be sane, do you not?"
"Well… yes…"
"Dogs wag their tails when happy and growl when angry, whereas I growl when I'm happy and wag my tail when I'm angry," continued the cat, lounging against the tree trunk. "Therefore, I'm mad."
"Oh, COME ON!" Usopp burst out. "All I want is to talk to someone with their head on straight! Is that so much to ask?!"
"Of me? Most certainly," replied the cat as he rotated his body around, his head staying in place. The body then placed one of its hind feet on top of the cat's head, balancing on it. "Can you stand on your head?"
Usopp stared blankly, his brain frantically trying to catch up with his eyes. Said eyes began widening more and more as he processed more and more what was happening in front of him.
Then it fully clicked.
A talking cat…
Was standing…
On top…
Of its own head!
"YAAAAAAAAHHHHHHHHH!" Usopp screamed, his eyes bugging out and his tongue flailing out of his mouth before taking off running into the forest once again, screaming the whole way.
After another hour of running, screaming, catching breath and searching – all in a repeated cycle – Usopp found himself in a glade of oversized flowers.
"Whew… finally! Something resembling normalcy!" he exclaimed with relief, before moving into a suspicious expression. "Of course, knowing my luck, they're gonna start moving or talking at any second…"
"Quite right, my dear!"
Usopp jumped. "Wh-who said that?!"
"Me, of course!"
Just then, a tall rose leaned over to Usopp from the side. Upon closer inspection, its inner petals had been arranged to form a face, which was now smiling pleasantly at him.
"GAH!" yelped Usopp. "I wasn't being serious when I said that! Flowers can't talk!" He then moved to a thoughtful expression. "Of course, neither can cats, and look what happened there…"
"Well, of course we can talk, my dear!" said the rose.
"If there's anyone worth talking to," said another voice, this one rather haughty. Usopp whipped his head around and spotted another moving flower; a purple iris this time.
"Or about! Tee hee hee!" giggled another voice, this time coming from a daisy.
"Oh geez!" cried Usopp. "Please at least tell me you're not gonna start standing on your heads, too!"
The entire glade gasped at what the long-nose said. "Stand on our heads?!" cried a lily.
"So strange!" said a pansy.
"How rude!" said the iris.
"What a thing to say!" said another flower.
"I'm sorry, I'm sorry!" cried Usopp, waving his hands in a placating gesture. "It's just, I ran into a cat earlier that could do that, and it freaked me out!"
"You mean the Cheshire Cat?" said the iris, sniffing arrogantly. "Hmph! Ever the uncouth one, that feline! I'm insulted to be compared to him!"
"Sorry," said Usopp sheepishly. "In any case, can you tell me how to get out of here?"
"Well, what kind of garden do you come from?" asked the daisy.
"That is to say, what species or genus are you?" asked the iris.
"Huh? What's that got to do with anything?" asked Usopp, confused.
"Well, if we know what kind of garden you're from, we could point you in the right direction," said the rose, that motherly smile still on her face.
"Hmm…" hummed Usopp, stroking his chin thoughtfully. He wanted to tell them he wasn't a flower at all, but given what the Cheshire Cat had said about everyone here being mad, he figured it would be more beneficial to him to play it to his advantage. It was then that he was hit with a stroke of inspiration.
"I've got it!" he announced with a smile, pounding a fist into his hand. "I'm an Usoppus humanus! Usopp, for short!"
"Oh, my!" said the daisy, before turning to the iris. "Did you ever see an Usopp with a blossom like that?!"
"I wouldn't even call that a blossom, my dear," replied the iris with disdain. "And come to think of it, have you ever even seen an 'Usopp?'"
"And he doesn't even have petals!" said the daisy.
The iris leaned in and sniffed the top of Usopp's head. "And no fragrance!"
"Hey! Personal space, lady!" snapped Usopp, backing away.
"I'm an iris, not a 'lady', you simpleton," she retorted.
"And those stems!" said the daisy, pointing at Usopp's legs.
"Rather scrawny, I'd say," said the iris.
"Well gee, aren't you polite!" snapped the liar, hands on hips in an indignant pose.
"Harrumph! You know what I believe?" said the iris, leaning in to Usopp. "I believe you're nothing but a common weed!"
"Oh, no!" a nearby group of tulips gasped all at once.
"What?! No, I'm not!" Usopp burst out.
"Well, you wouldn't expect him to admit it!" "Quite right!" "Can you imagine?!" A whole gaggle of voices spoke to each other all at once in a frenzy.
"Come to think of it, he rather looks quite like that other weed that came through here not too long ago, wouldn't you say?" said the iris.
"By Jove, you're right!" said the rose.
"He's just like that one who called herself an 'Alice'!" said the daisy.
Usopp's ears perked up at that. Another 'weed'… with the name Alice? Does that mean some other person came through here too? he wondered to himself.
"Wait! Who's Alice?" Usopp called out over the voices, hoping to make himself heard. If there was another normal person in this madhouse of a forest, there was a chance she could help him out! "Where is she?! Where can I find her?!"
"As if we would know that!" said the iris indignantly. "We don't associate with weeds! Off with you!"
"Yes, off with you! We don't want you spreading seeds around here!" said the daisy, making a shooing gesture. The rest of the flowers followed suit, forcefully brushing and shooing Usopp away to an area out of the glade.
"Alright, alright! Quit shoving! I'm going! Enough already!" complained Usopp as he made his way out. "I'm sick of talking to you anyway! Consider yourselves lucky I didn't set you all on fire!" he added as a parting shot before turning around and storming out of the glade.
"Geez, what was their problem? Acting all high and mighty just because I was new in the area…" Usopp fumed as he made his way through the forest. He then sighed. "And I'm still no closer to getting out of here. Some help they were. All they told me is that there's someone else named 'Alice' around here…"
Usopp perked up as he heard the sound of music and singing from a distance away. It was too far away to make out what anyone was saying, but he knew music when he heard it. Treading carefully so as not to draw attention to himself, the long-nose began making his way towards the source.
Before long, Usopp found himself at the entrance to a clearing occupied by a white cottage with a thatched straw roof, though everything about it was built at strange angles; even the door and chimney were at a slant. The music itself seemed to be coming from the backyard, which was fenced off by a wall of hedge with a small white wooden gate. And hanging on strings drawn across the backyard were a number of brightly colored paper lanterns. The music seemed to be coming from within the backyard, with a faint cloud of what looked like steam emanating from it. Getting curious, the sniper decided to take a closer look.
Upon entering the backyard, the long-nose was greeted by the sight of a long, large table with a pink tablecloth surrounded by several empty chairs. On top of said table were a large number of teapots, teacups, bowls, jars, and plates of various small treats and snacks. The strange part was that the teapots were piping out the music he had been hearing through their spouts like flutes and piccolos, and were even hopping and bouncing to the beat. Still, Usopp was somewhat used to the strangeness of this place by now, so it didn't faze him much. What truly caught his eye, though, were the two small people singing at the other end of the table. It was hard to make them out through the steam haze that hung over the table, but he could hear their singing fairly clearly.
A very merry unbirthday, to me!
(To who?)
To me!
(Oh, you!)
A very merry unbirthday, to you!
(Who, me?)
Yes, you!
(Oh, me!)
Let's all congratulate us with another cup of tea!
A very merry unbirthday toooooooooo yooooooouuuuuuuu!
The music stopped. Huh, kinda catchy, Usopp thought to himself. He then seized his chance to get their attention. "Excuse me!"
The two quickly turned their heads in his direction. "No room! No room! No room!" they began repeating over and over as they began scrambling over towards the sniper, hopping over each other over and over like a game of leapfrog.
As they got closer, Usopp could finally see what they looked like. One of them was a small man with rather large front teeth dressed in a mostly green suit. Each piece was a different shade of green, and the bow tie was blue. What stood out most was the large green top hat on his head, far larger than it needed to be, with a slip of paper in the ribbon that read "10/6". The other was what looked like an oversized rabbit dressed in mostly red. Nothing stood out too much about it, aside from its clothes and the mop of blond hair it sported beneath its large ears.
"No room?" said Usopp, looking skeptical. "But there's lots of room! Look at all the empty chairs!"
"Ah, but it's very rude to barge in on a party without being invited!" said the rabbit matter-of-factly, wagging his finger at the long-nose.
"I'll say it's rude!" said the green-clad man, also wagging his finger. "It's very, very rude indeed!"
"Sorry, sorry," apologized Usopp. "I'm sorry to intrude, but I just wanted to ask: Where am I?"
"Oh, that's very simple!" spoke up the rabbit. "You're here!"
"Well, I know that!" said Usopp. "But I…"
"Well, if you already knew, why did you ask?" asked the green-clad man, interrupting Usopp.
"Argh! That's not what I meant!" exclaimed Usopp in frustration. "What I want to know is, where is here?"
"Well, that depends," said the rabbit. "If you're not here, then maybe there?" He pointed to an arbitrary spot in the surroundings.
"No! I'm not there, I'm here!" said Usopp, getting more and more annoyed with these two. "What I want to know is where here is!"
"Well, why didn't you say so?" said the green-clad man. He then gestured to the rabbit. "The Hare is right there!" He paused. "Oh hey, that rhymes!"
"NO! That's 'HARE' with an 'A'! I want to know about HERE! This current location! Where. Is. HERE?!" Usopp shouted.
"Right here, of course!" said the man jovially. "At the Mad Hatter…" He gestured to himself. "And March Hare's…" He gestured to the rabbit. "Very merry unbirthday party!"
Usopp's temper began to flare once again, but stopped when he suddenly remembered his conversation with the Cheshire Cat. "If I were to seek a way out, I'd ask the Mad Hatter… or the March Hare."
So these are the two he mentioned, Usopp thought to himself. They just might be able to help out!
He then groaned inwardly; if their exchange just now was any indication, he could already tell he was in for a huge headache. Even Luffy wasn't this obtuse. However, he couldn't help but be curious about something they had just said.
"Um, what exactly is an 'unbirthday'?" the sniper couldn't help but ask.
The two gasped dramatically. "You don't know what an unbirthday is?!" exclaimed the Hatter.
"He doesn't know what an unbirthday is?!" exclaimed the Hare toward the Hatter.
"He doesn't know what an unbirthday is!" the Hatter exclaimed back. "How silly!"
"Oh, this simply will not do! Come, come! Sit down!" said the Hare, grabbing Usopp's hand and dragging him over to an empty chair before sitting on a chair to Usopp's left, while the Hatter took a seat to Usopp's right. "While we talk, why not have some tea?" he continued, producing said beverage in a cup and saucer.
Usopp was taken aback. Just a few moments ago, these two were berating him for barging in, and now they were welcoming him to the table and even serving him tea! These guys' attitudes changed faster than an angry Sanji with Nami around!
"Um, thanks," said the sniper uncertainly, hesitantly taking hold of the cup and saucer. "So, you were saying about an 'unbirthday'?"
The Hare promptly pulled the cup and saucer away from Usopp at the question. "Oh, it's very simple! You see, every year, everyone only gets one birthday! Imagine! Just one birthday every year!"
"Ah, but there are 364 UNbirthdays in a year!" the Hatter said cheerfully.
"And that's why we're gathered here to cheer!" said the Hare.
Usopp ruminated on this for a moment. "So… you're saying that every day in the year that ISN'T a birthday… is an UNbirthday?"
"Precisely!" confirmed the Hatter.
"So… that technically means that today is my unbirthday too!" said the sharpshooter.
"It IS?!" gasped the Hare.
"What a small world it is!" said the Hatter happily.
"In that case…!" As the Hare spoke, he leapt off of his seat, dragging Usopp along with him. Once they were in the open, both the Hare and the Hatter began dancing around him, singing. The teapots proceeded to supply the music.
"A very merry unbirthday!"
"To you! To you!"
"A very merry unbirthday!" Here, the Hatter lifted his hat and presented Usopp with a pink and white frosted cake with a single lit candle on it.
"For you! For you!"
Usopp was surprised. He wasn't expecting to be served a whole cake!
"Now blow the candle out, good sir, and make your wish come true!"
Playing along, Usopp took a deep breath and blew out the candle… only for it to start flinging out multicolored sparks before the entire cake launched off the plate like a rocket.
"A very merry unbirthday… to yooooooooooouuuuuuuu!"
The Hatter and Hare finished their song as the cake flew into the sky and exploded into a shower of sparkles like a firework. The sniper was awestruck; a cake firework?! Despite his impression of these two, he couldn't help but find it to be rather clever, having dabbled in fireworks himself at one point. Maybe these guys weren't so bad after all!
"So, my good fellow," began the Hatter once the three of them sat back down, Usopp laying his bag on the ground next to his chair. They also presented him with another cup of tea. "What brings you to our party?"
"Well…" began Usopp as he lifted his cup, before it was promptly snatched away by the Hatter. "Hey! I was going to drink that!" he said irritably. Why did they keep taking his tea away right before he could take a sip?!
"Ah, but you can't tell your story if you have tea in your mouth, silly!" chuckled the Hatter, taking a sip himself. Usopp twitched at the logic; why even give him the tea to begin with?!
"Riiiiight…" he drew out before getting back on track. "Anyway, a couple of hours ago, I ran into a talking cat…"
"CAT?!"
A mouse suddenly burst out of a teapot nearby, looking scared out of its mind. "CATCATCATCATCATCATCATCAT…!" it squeaked repeatedly as it dashed across the table.
The Hatter and Hare immediately leapt into action and chased it across the table, knocking over and scattering teapots, cups, saucers, bowls, and plates in the process. Before long, they managed to pin the mouse down. "Get the jam! Bring the jam over! Quick!" the Hare yelled to Usopp.
The sniper began frantically looking around before spotting a jar of jam nearby. Snatching it up, he quickly ran over to where the three partiers sat, still working to keep the panicking mouse under control. "Wipe it on his nose! Quick!" said the Hatter. Usopp blinked at the request, but did as he asked, grabbing the butter knife in the jar and smearing a bit of jam on the mouse's nose. It had an immediate effect as the mouse instantly calmed down, now looking incredibly sleepy as the Hatter placed it back in its pot and put the lid on.
"My goodness!" said the Hatter, brushing himself off. "Those are the things that upset me!"
"See all the trouble you've started?!" said the Hare indignantly, pouring himself some more tea over his head… before cutting the tea stream with his ears like a pair of scissors.
"Well, how was I supposed to know?!" Usopp burst out in frustration. "You're honestly asking me to automatically know there was a mouse in a teapot that reacted badly to hearing anyone say – ulp!" He quickly clapped a hand over his mouth before saying it out loud.
"Hearing anyone say what?" asked the Hatter.
"Um… C-A-T?" the sniper ventured.
"Tea? Why, certainly!" said the Hatter, grabbing a teapot.
"What?! No!" cried Usopp. "I was spelling out the word so I wouldn't have to…!"
"Say, what are these?"
Usopp looked again and saw the Hatter peering at his goggles, turning them over in his hands.
"WHAT?!" He reflexively reached up and felt the top of his head, finding said goggles missing. "How?! When did you - ?!"
"Strangest glasses I've ever seen! Can't see why you'd need them!" With that, the Hatter promptly tossed them over his shoulder into the bushes.
"HEY! What are you doing?! Those are mine!" Usopp shouted, dashing over and digging around for his goggles.
"And what's this stuff?" said the Hare, pulling a bottle of red liquid out of Usopp's bag and reading the label. 'Tabasco sauce'? Never heard of it!" He tossed it over his shoulder.
"Hey! Stop! You'll break it!" the sniper yelled as he dashed over and dove to catch the bottle in one hand, his other hand gripping the goggles he had just fished out of the hedge as he flopped to the ground. Thankfully, the bottle remained unbroken. I take it back! These two really ARE so bad! he thought to himself.
The Hatter and Hare continued rooting around in Usopp's bag, pulling things out at random and carelessly tossing them over their shoulders, forcing the long-nose to run every which way to catch them.
"Hey, HEY, HEY! THAT'S MY STUFF! STOP THROWING IT AROUND!" Usopp shouted as his various gadgets and tools continued piling up in his arms. After catching a coil of rope on top of the pile of stuff in his arms, he finally had enough. Running over, he swiped his bag back with one hand and dumped everything back in, glaring angrily at the two.
"Now what's this doohickey?" said the Hatter, holding up Usopp's slingshot. "Some kind of mouse clothesline?"
"That's my slingshot, I'll have you know!" snapped Usopp, snatching it back out of the Hatter's hand. "My pride and joy!" He then pulled out a Lead Star and loaded it into the sling, stretching it back and aiming threateningly at the Hatter. "And if you try to mess with my stuff again, you'll regret it!"
To Usopp's surprise, the Hatter and Hare simply started laughing. "You call that a slingshot? How silly!" laughed the Hatter. With a flourish, he proceeded to lift his hat and pull out… an even bigger slingshot! It was at least twice as large as Usopp's, with six rubber bands set between the prongs. "THIS is a slingshot!" the Hatter finished proudly.
Usopp gaped for a moment, before putting on a cocky grin. "I beg to differ!" he laughed as he reached into his bag and pulled out an even bigger slingshot. "THIS is a slingshot!"
"That's what you think!" said the Hatter as he pulled out another even bigger slingshot!
"Oh, it's on now!" declared Usopp, pulling out yet another even bigger slingshot!
This continued the same way for a while, the Mad Hatter and Usopp repeatedly pulling out slingshots even bigger than their opponents' one at a time. Before long, said slingshots had extended higher than the treeline… then were visible from space… then were as big as the planet itself… then bigger than the sun… then as big as a galaxy. Usopp then pulled out a slingshot as big as multiple galaxies before instantaneously growing large enough to load a smaller galaxy into the sling, pull back, and launch it down, setting off a massive explosion that shook the foundations of the universe!
"WHO THE HELL DO YOU THINK I AM?!" Usopp shouted, posing triumphantly.
Present Time
"And that's how I, the Great Captain Usopp, defeated the dreadful Mad Hatter and March Hare!" said Usopp proudly. He then looked over to his audience… only to see Sora, Donald, Goofy, and Jiminy looking at him with their eyebrows tabled, looking thoroughly unimpressed.
Luffy, on the other hand, was practically drooling with excitement, his eyes glowing. "COOOOOOOOOOLLLLLL!" he exclaimed.
"Is that REALLY what happened?" asked Sora, raising an eyebrow skeptically.
"I think we woulda seen it if it did," said Goofy, equally disbelieving.
"I agree; it's not something anyone anywhere would easily miss," said Jiminy.
"Just who are you trying to fool, buddy?!" demanded Donald.
Usopp gaped and spluttered, floundering for a moment before sighing and slumping in defeat. "Fine. You got me. Here's what really happened…"
Back to Earlier
Usopp gaped at the size of the slingshot, his own drooping at the sight. "Oh… my pride…" he moaned, looking sadly at his trusty weapon.
The March Hare scoffed. "Slingshots are for sissies!" he said before reaching into his sleeve and pulling out… a HUGE bazooka. "THIS is the mark of a REAL man!" He then pointed it at Usopp.
Usopp's eyes went white with shock and terror as his jaw dropped, a small amount of mucus dribbling out of his nostrils as his knees shook. Unable to form any words, he instead held up a small sign that said 'EEP!'
"Catch!"
A teacup came flying through the air toward Usopp, who dropped his sign and caught it on reflex. This snapped Usopp out of his reverie enough to speak. "W-w-what's this for?" he asked shakily.
The Hare pulled the trigger on the bazooka… only for a small trickle of tea to come squirting out, filling the sniper's cup. "I can't serve you tea if you don't have a cup!" said the Hare as if it were the most obvious thing in the world.
"Precisely!" said the Hatter as he grabbed a handful of sugar cubes. "And I can't serve you sugar if you have no tea!" He then used his slingshot to fire three cubes into Usopp's cup, one after the other, before proceeding to fire sugar cubes into every other cup on the table.
SERIOUSLY?! thought Usopp incredulously. That was just a way to serve tea?! He shook his head. Then again, why did I expect any different from THESE two?! Saying nothing, he placed his slingshot back in his bag (making sure to clip it shut this time), walked back to the table and sat down, lifting his teacup to his lips.
"Hold on, now!" said the Hatter, snatching the teacup out of Usopp's hand. "We can't have you with a full mouth while we're trying to make conversation!"
"But…!" started Usopp, his aggravation rising once more. They were doing this again?! "You JUST GAVE IT TO - !"
"I have an excellent idea!" said the Hare, cutting off the long-nose as he raised a finger. "Let's change the subject!" With that, he carelessly tossed his bazooka into the air… only for it to land on the Mad Hatter's head with a thud, squishing his hat down over his head and causing him to drop his slingshot. But before the sniper could even register what just happened, the brim of the Mad Hatter's hat peeled open and began to speak.
"Why is a crocodile like a fruit?" said the Hatter, speaking as if nothing had just happened, the brim of his hat flapping like a mouth as he spoke.
Usopp looked bewildered at the display, but couldn't help but be intrigued by the statement. "A riddle, eh? Hmmm…" He racked his brain, trying to find a correlation between the two. However, nothing came to mind, no matter how hard he thought. "I give up. Why is a crocodile like a fruit?" the sniper asked.
The Hatter pulled his hat back up on top of his head. "Beats me! Haven't the foggiest idea!" he said.
"What?! Then why did you pose the riddle to begin with?!" yelled Usopp.
"We were hoping you knew!" said the Hare indignantly. "If we knew the answer, we wouldn't have asked the question! That's just common sense!"
Usopp finally had enough. He was just about to get up and storm out before he was struck with an idea. The more he thought about it, the better it sounded. A mischievous grin appeared on his face; if this was how things were going to be, he might as well have a little fun with it. With that, he moved his face back to a more pleasant expression as he cleared his throat.
"Say, my good sirs…" began Usopp in a rather posh voice, raising a finger for emphasis.
"'My good sirs!'" repeated the Hatter. "Now why exactly would you have me say that?"
Usopp twitched at the leap in logic, but soldiered on. "Seeing as you have quite a fondness for tea…"
"Yes, of course! Can't have an unbirthday party without it!" interrupted the March Hare.
"…I was wondering if maybe you'd like to sample a new ingredient I've been working on," finished the sniper.
"A new ingredient?!" exclaimed the Hatter, his hands on his cheeks in shock. "Inconceivable! Surely you can't be serious!"
"Oh, I'm very serious," continued Usopp with a pleasant smile, though he instantly shifted to a mock frown. "And don't call me Shirley."
"Oh! Terribly sorry! Do go on!" replied the Hatter.
"As I was saying…" continued Usopp. "I have created a new ingredient for tea, and I'd like you two to sample it."
"Well now, what sort of ingredient?" asked the Hare.
"Just a little extra something to enhance the flavor," said the sniper with a sneaky grin as he pulled a bottle out of his bag, purposely covering the label with his hand as he pulled the top off with his other hand. "Hold out your teacups."
The two partiers did so, and Usopp shook a healthy amount of the liquid in the bottle into each cup.
"Now have a sip, and let me know what you think," finished Usopp. His outwardly pleasant smile remained, but inside, he was laughing evilly. He then raised a teacup of his own. "Bottoms up!"
The Mad Hatter and March Hare promptly tossed away their teacups and raised their rear ends into the air.
Usopp looked on in confusion. "Uh, what are you two doing?" he asked hesitantly.
"You said 'Bottoms up', didn't you?" asked the Hatter from his upside-down position.
"Well, yeah, but I meant…"
"Ah, but that's the point!" said the Hare in a lecturing tone, somehow managing to wag a finger at him despite also being upside-down. "You should always say what you mean and mean what you say!"
"I'll… keep that in mind," said Usopp slowly as he reached for two new cups of tea, again shaking the contents of his bottle into them and passing them to the two partiers, who were now right side up once again. "Now again, have a sip and let me know what you think."
"Very well, then!" declared the Hare as he raised his cup. "Down the ha – !"
"CLEAN CUP! CLEAN CUP!" the Hatter shouted suddenly, dropping his teacup.
"Wait!" protested Usopp. "You didn't drink your – !"
"Move down! Move down! Move doooowwwwn!" continued the Hatter, grabbing Usopp by the arm and dragging him along the table, the March Hare pushing him from behind.
Argh! So close! thought the long-nose irritably. Okay, calm down, Usopp; you can still make it happen!
"Now then, good sir, you said you had something for the tea?" asked the Hatter.
"Yes, I did," replied the sniper. "Here, let me get it for you." He then grabbed a random teapot, took off the lid and dumped another large amount of liquid into the tea inside. He then replaced the lid and swirled the tea a bit to mix it up before handing it off to the March Hare.
"For me? How very thoughtful! How did you know it was my unbirthday?" the Hare responded happily, taking the pot and tipping it to pour out the tea. But before any liquid came out, he stopped.
"Waaaaiiiit a minute! Wait just a minute here!" the Hare exclaimed indignantly, bringing the pot up to eye level and eyeing it suspiciously.
"Um, wh-what is it?" asked Usopp nervously. Had he been found out?!
"This is the purple pot!" the Hare said, throwing the pot over his shoulder into the nearby bushes. "You can't drink tea from a purple pot! Makes it taste purple!"
"What…! I…! But…! You're the ones who put it on the table and filled it with tea to begin with!" sputtered Usopp. "And purple doesn't even have a flav – ! Oh, forget it." He slumped over on the table in defeat.
"Now, now! No one likes a Sad Sally at an unbirthday party!" said the Hatter jovially. "Here, have some tea! It'll perk you right back up!" He picked up a pot and began pouring its contents into… his shirt collar. The tea then began pouring out of his sleeve into a cup.
"Ugh… why do I bother?" moaned Usopp, half-heartedly taking the cup. "It's not like I'll even get to drink…" He stopped, a light bulb appearing over his head as he was hit with an idea. He then straightened back up.
"Say, fellows," began the liar, back in his posh voice as he grabbed a second, empty teacup. "Do you know what's BETTER than a cup of tea to aid an ailing heart?"
The two partiers gasped dramatically. "BETTER?!" cried the Hatter. "Impossible! Perish the thought!"
"Indeed! NOTHING can be better than a cup of tea for those down in the dumps!" added the Hare. "He's mad! MAD, I say!"
"TWO cups of tea!" declared Usopp as he poured himself a second cup.
"TWO cups?!" exclaimed the Hatter, smacking himself on the head. "Now why didn't I think of that?!"
"You Mindless Marvin, you! Bad! Bad Hatter!" scolded the Hare as he jumped up on the back of Usopp's chair, pulled out a large wooden hammer and gave the Hatter a few rapid knocks over the head with it.
While that was going on, Usopp quickly pulled his bottle back out and dumped a generous amount of its contents into each cup. He then picked up both cups and began slowly lifting them toward his lips.
"Now now! No need to be so greedy with the tea!" interjected the Hatter as he swiped one of the cups from Usopp.
"Indeed! No one likes a greedy-gobs, especially at a party!" added the Hare, swiping the other cup.
"But that was MY tea!" whined Usopp.
"Correction: EVERYONE'S tea!" replied the Hatter before taking a big gulp.
"Indeed! All refreshments are for everyone at a party!" said the Hare before rapidly downing his own cup.
Usopp grinned evilly. He had finally beaten them at their own game! "Hope you like it HOT!" he taunted as he began rising out of his chair.
"Well, of course!" replied the Hatter indignantly as he wiped his mouth. "Why would anyone ever not drink it..." Before he could finish his sentence, both he and the Hare's faces started going red and began sweating profusely. Steam began pouring out of their ears with the sound of a teakettle whistle before their heads tipped upward and jets of flame erupted from their mouths. "HOOOOOT!"
"Enjoy my special 'Tabasco Tea!' HAHAHAHAHA!" And with that, Usopp quickly grabbed his bag, jumped up and dashed off back into the forest, laughing maniacally the whole way.
Once the jets of fire petered out, the two partiers began coughing and pounding their chests, bursts of smoke coming out with each cough. The Mad Hatter then smiled. "I say, that was certainly a good addition to the tea!" he commented cheerfully.
"Yes, yes! Certainly gave it some kick!" replied the March Hare jovially.
"Oh, but he ran off with the rest! How rude!"
"Indeed! Quite unmannerly, that one!"
The two then launched back into their 'Very Merry Unbirthday' song, blissfully unaware of the black, yellow-eyed creatures forming from the ground behind their chairs…
After a short while of running and laughing, Usopp found himself in another clearing, this time surrounded by hedges and rose bushes with white roses.
"Hah… hah…" Usopp breathed heavily from the effort. He then looked up to see a grey, cloudy sky. Not particularly cheery, but after everything he had just been through, to Usopp it was like the gates of Heaven itself.
"I'm out of the forest… I'M OUT OF THE FOREST!" he cheered, doing a small victory dance. "I thought I'd NEVER get out! I'm free! I'm free!"
His big moment of elation was then brought crashing down as he was hit with an unpleasant realization. "I'm out of the forest… but NOW where am I?!"
"I do believe you're in a hedge maze, good sir!" said a polite, young-sounding voice from the side.
Usopp whipped around toward the source of the voice, a crazy look in his eyes. "How can you be so calm?!" he cried, gesturing wildly. "Don't you know what's going on?! This world is pure insanity! Up is down! Left is back! AND FLOWERS TALK! We're not in a hedge maze, we're… in…" He trailed off when he focused himself enough to take a good look at the one he was ranting to.
She was a young girl, likely no older than 12. She wore a plain blue dress covered by a white apron, with white stockings and black shoes. She had long blonde hair done up with a black bow, and rather striking blue eyes which now looked back at the pirate a bit fearfully due to his outburst. Aside from that, nothing in particular stood out about her; she looked perfectly normal. But given everything Usopp had been through today, 'normal' was exactly what he needed right now!
Still, looks could be deceiving. How could he be sure she wasn't going to suddenly turn into a bug, or start honking like a goose?
Suddenly, he remembered back to his encounter with the flowers.
"Come to think of it, he rather looks quite like that other weed that came through here not too long ago, wouldn't you say?" said the iris.
"By Jove, you're right!" said the rose.
"He's just like that one who called herself an 'Alice'!" said the daisy.
"Um… your name wouldn't happen to be 'Alice', would it?" he asked tentatively.
"Why, yes!" she said, putting a surprised hand to her mouth. "But how did you know? We've never met before!"
"Let's just say I wasn't kidding when I said the flowers talk around here," he said, smiling awkwardly while rubbing the back of his head.
"Oh, I know! I ran into them too! Rather rude bunch, if you ask me!" said Alice with indignation.
"I know, right?! And the Mad Hatter and March Hare were just unbelievable!"
The exchange continued in much the same way for a short while, the two comparing experiences in the forest and sharing laughs. Alice even let him in on some run-ins with residents he himself had not encountered, like a smoking caterpillar and two rather strange fellows by the names of Tweedledee and Tweedledum. It had been a nice moment…
…only for it to get interrupted.
"AHA! Found you!" came a voice from the side. Usopp and Alice looked up to see a group of what looked like playing cards, except they had hands, feet, and armored heads, and also carried lances tipped with the symbol of their respective suit, which in this case were Hearts. Usopp could only groan at this sudden appearance of even more weirdness.
"I beg your pardon?" said Alice, surprised.
"Her Majesty, the Queen of Hearts, has ordered us to find you and take you to her!" said the card at the front of the crowd, a 3 of Hearts, pointing his lance at her. The two could only assume he was their leader. "And that's exactly what we intend to do!"
"But why?" asked Alice.
"It matters not! All that matters is that you come with us immediately!" commanded the lead card.
"Well, I'm not going!" she said with a defiant stomp of her foot, hands on hips. "I've had enough of dealing with your Queen! And if she doesn't like it, she can sit on a pin!"
"Consider yourself lucky the Queen wasn't here to hear that, young lady! Or you would have lost your head on the spot!" barked the leader. "Now come with us! Or we shall have to bring you to Her Majesty by force!"
Alice continued glaring for a moment, then looked thoughtful. She then smiled. "Alright then, I'll come with you," she said, a bit overly pleasantly. The cards began marching towards her.
"Buuuut…" she drew out, leaning forward and raising her finger in a teasing manner, "you'll have to catch me first!" She then turned on her heel and ran off as fast as she could in the opposite direction towards one of the corridors of the maze.
"Hey, wait! Don't leave me alone here with these guys!" Usopp cried, quickly giving chase.
The two disappeared into the corridor, running as hard as they could through the winding maze. The sniper barely registered the sound of the 3 of Hearts shouting "AFTER THEM!" as they fled.
Just then, a section of the hedge wall rolled to the side, revealing an entryway… right back into the forest.
"Wait... No! NOOOO!" Usopp screamed as he attempted to skid to a stop. He just got out of the forest! No way was he going back in! Poison him, drown him, bash him in the head, but for the love of all that was holy, NOT THE FOREST AGAIN!
Too late. Usopp's toe ended up catching in the turf, causing him to fall and start tumbling head over heels forward. Alice, being right in front of him, ended up getting caught in the tumble herself, and with a small cry of surprise from the blonde, the two rolled forward in a heap right through the entryway. As soon as the two of them fell through the threshold, the portal closed behind them. The roll soon stopped, leaving the two piled on top of each other with spirals in their eyes.
"Oh, goodness," said Alice as she stood up, breathing heavily as she dusted herself off. "Are you alright, sir?"
"I… I think so," Usopp managed to get out, recovering from his daze.
"Oh dear," Alice continued as she took stock of the surroundings. "I'm back in the forest again!"
"Don't remind me," Usopp groaned as he got to his feet. "I spent HOURS trying to get out of here, and now I'm back! This place is driving me crazy!"
"Well, at least those card men aren't after us anymore," Alice offered, trying to cheer him up.
"That's true," said Usopp. Then, on reflex, he slid into his usual false bravado. "But naturally, I could have easily taken them all on! I'm the Great Captain Usopp, the greatest pirate who ever lived! Not that I'd need the help, but my 5 million followers could have wiped them out in the blink of an eye, and still be ready for more!"
Usopp then looked over to see Alice looking at him skeptically, her arms crossed and an eyebrow raised. "Really, now?" she said.
"What, you don't believe me?" replied Usopp, still maintaining the façade with a confident grin and grandiose voice. "Come, child, and I shall regale you with the tales of my exploits upon the seas!"
As the two began walking through the forest, Usopp proceeded to launch into a number of his usual tall tales from back in Syrup Village, like the one about the island he discovered that turned out to be the excrement of a giant goldfish, before slicing up said goldfish and sending it to a country of dwarves. Or the time he fought off a whole horde of dragons attacking his village. Or the time he took on a giant skeleton centipede with scythes for limbs and came out without a scratch. Or the time he slayed eighteen colossal beings several times the size of all the buildings in Syrup Village combined without even breaking a sweat. Or the time he traveled through time with his friends to prevent the end of the world at the hands of a terrible monster from the stars.
Alice listened with great interest. She didn't believe a word of it, and Usopp knew it, but that was the point: To entertain. With his mind so stretched to the limit by all the insanity he had experienced, he needed some familiarity to anchor himself and keep from losing his mind, and there was no better way to do so now than telling his tales to a captive audience. She laughed. She gasped. She cheered. The stories may not have been true, but she was enraptured all the same.
Just like with Kaya.
"THERE THEY ARE!"
The two jumped in surprise at the voice shouting behind them. Turning around, they noticed the same card guards from before charging towards them.
"Oh, for goodness' sake!" Alice said with frustration before dashing off again, Usopp following close behind.
As they ran, Usopp noticed that the surroundings looked rather familiar. "Wait a minute… isn't this where…?" Then it clicked.
This was the same glade from before with the talking flowers!
"You again?!" came the familiar arrogant voice of the purple iris. "Didn't we tell you weeds to go away?!"
Usopp was in no mood for her attitude at the moment. "Oh, go eat some fertilizer, you miserable old bat!" he shouted as he and Alice dashed through.
The entire glade gasped at Usopp's words. "Well! How very rude and uncouth!" said iris sputtered, the rest of the flowers tittering in agreement.
"Those who live in glass houses shouldn't throw stones!" Alice called out over her shoulder as she and Usopp disappeared into the bushes, the card guards following soon after.
Not long after exiting the glade, a large tree split in half to reveal a new portal right in Alice and Usopp's path. Not seeing any other options, the pair quickly ran through. The portal closed itself immediately after, cutting off the card guards' pursuit.
"Good… we lost them again…" said Alice as the two of them caught their breath.
"As if we needed to!" declared Usopp, sliding back into his 'Captain Usopp' persona. "I, the Great Captain Usopp, could take them on any time with one… no, BOTH hands tied behind my back! And a leg, too, for good measure!"
"Oh, really? Where was that 'Great Captain Usopp' while we were running away, hmmmm?" said Alice with a canny smile on her face.
Usopp began sweating a bit under her scrutiny. "Um, uh… hey! Did I ever tell you about how me and my friends saved my village from a crew of cat pirates?" he replied nervously, attempting to change the subject.
Alice continued looking skeptically at him, but then relented, deciding to humor him. With that, Usopp proceeded to launch into the stories of himself and the Straw Hats in East Blue and the Grand Line, the two of them walking along the corridors of the hedge maze as he did so. He continually tried to convince her that these stories were in fact true, but naturally, after the first crop of stories, she wasn't exactly open to the idea. All the same, though, she thoroughly enjoyed listening to them.
"Say," said Usopp as he and Alice stepped into another clearing, breaking away from his stories for a moment. "I never did ask, what were you doing here in the maze before you bumped into me? You never mentioned anything about that when we were talking earlier."
Alice stopped in her tracks, a fearful expression on her face.
"Alice? Are you alright?" the long-nose asked, looking back at her. "Did something bad happen?"
"Oh, it was dreadful!" Alice began, shivering, but resuming her walk. "I was in the middle of playing a game of croquet with the Queen of Hearts - though you could hardly call it a 'game', the way she was playing it - when these horrible black creatures suddenly came popping out of the ground!" She shuddered. "They looked like giant insects with claws, and they had these terrible glowing eyes!"
She swallowed. "They just started attacking everyone in sight! Everyone they got to just disappeared, and some strange glowing hearts went flying into the sky when they did! I just barely managed to get away!"
She paused when she noticed Usopp no longer walking beside her. "Mister Usopp? Are you alright?" she asked, looking back.
Usopp stood stock still, his entire body shaking as beads of sweat rolled down his entire body, an utterly terrified expression on his face as trails of mucus came out of his nose. "Th-th-the g-g-ghosts…! Th-they're h-h-here…!" he stammered. "I'm doomed! They know I'm here! THEY'VE COME TO FINISH ME OFF!"
"What are you talking about, Mister Usopp?" asked Alice, now looking bewildered. "Are you saying you've run into…?"
"FOUND YOU!"
The two jerked their heads up at the familiar sound of the lead card guard's voice. Alice sighed in frustration. "Come on, Mister Usopp!" said Alice as she began running once again and disappeared into the maze, Usopp not far behind. Not long after the two of them went into the maze, they heard the telltale sound of several pairs of feet running behind them.
"STOP IN THE NAME OF THE QUEEN!" Usopp heard the lead card shout as he and Alice rounded a bend, causing him to slow down momentarily and look back to see the crowd of cards catching up to them. "Eek!" he squeaked before redoubling his pace… only to find himself at a fork in the corridor, with Alice nowhere in sight.
"Oh crap!" he exclaimed. "ALICE! Where are you?!"
"Over here!" she called back, her voice coming from the corridor leading right.
"Hang on! I'm coming!" he called back as he ran into the right-hand corridor and ran as fast as he could through the winding hedges… only to be met with another fork.
"Oh, for crying out loud!" he shouted with frustration. He got ready to call out to Alice once again… only to hear the sound of the cards' footsteps rapidly approaching from behind!
"Gah!" With no time to think, Usopp randomly picked the left corridor and ran, hoping against hope that he had picked the right direction.
Before too long, the sniper found himself in another clearing, breathing heavily. As he caught his breath, Usopp noted with some exasperation that Alice was nowhere in sight. He had clearly taken a wrong turn somewhere. Moments later, the card soldiers came dashing into the same clearing.
"Argh! Where did she go?!" yelled the 3 of Hearts.
"Sir! She seems to have gotten away!" said one of the other cards.
Well, at least she's safe from these guys for now, the long-nose thought to himself. He couldn't explain why; he just felt a sudden sense of protectiveness for the girl.
"Gah! We'll lose our heads if we don't get her to the Queen soon!" cried the lead card, clutching his head in frustration.
"What shall we do, sir?" asked one of the guards.
"Well, we need to show the Queen SOMETHING!" the 3 of Hearts replied a bit frantically.
The lead card then looked at Usopp, a thoughtful expression on his face. He appeared to get an idea as he turned around and gathered his troops into a huddle. After a short while of whispering and soft talking amongst the cards, they broke the huddle and looked intently at the sniper, who began sweating profusely as they spread out to form a semicircle around him.
"Guys…" said Usopp shakily, holding out his hands defensively. "Let's talk about this…!"
"NOW!"
"YAAAAAHHHHH!"
With that, the entire group of cards dogpiled the pirate. A struggle ensued, kicking up a large cloud of dust that obscured what was happening inside of it. An outside observer would have been able to see a limb or two from either Usopp or a card soldier occasionally poking out before zipping back in, as well as hands holding various bits of clothing. There was even a moment where Usopp attempted to crawl his way out of the fray, only to be quickly dragged back in. Several marks were left in the turf from him digging his fingers into the ground.
After a few minutes, the struggle ended and the dust settled… to reveal Usopp dressed up in a blue dress, white apron, and blond wig. His bag of tricks had also been confiscated in the process. Upon getting a good look at his new attire, Usopp yelped.
"GAH! What the hell?! Why did you dress me like this?!" said the sniper angrily.
"The Queen demands an audience with the blond-haired girl in a blue dress with a white apron!" the 3 of Hearts responded. "But since the real one has gotten away from us, it'll have to be you!"
"What sense does that make?! Do I look like a girl, even with this getup?!" yelled Usopp.
"If the Queen doesn't notice, that's good enough for us!" the 3 of Hearts replied. "Think of it as punishment for blocking our efforts to grab the girl!"
"Heart Squad, report!" came another voice from the side. The sharpshooter looked to see another group of cards come in from the side, this time marked as spades.
"Spade Squad! Good timing! We have apprehended the suspect!" said the lead Heart card to the lead Spade card.
The Spades looked over at Usopp. "Perfect! The Queen will be pleased!" said the lead Spade.
"Wait, WHAT?!" Usopp yelped. They had been fooled by the outfit?!
"You're coming with us, little girl!" said a 7 and 9 of Spades as they grabbed Usopp by each arm and began marching him out of the clearing, the Spade squad following close behind and the 3 and 5 of Hearts leading the way.
"BUT I DIDN'T DO ANYTHING!"
"You two!" barked the 3 of Hearts, pointing to two other Heart cards as they passed. "Stay behind and make sure those roses over there get painted red! You know what will happen if the Queen sees white roses!"
"Yes, sir!" said the two cards, saluting.
"Excellent! Now to get the suspect to the Queen!"
"BUT I'M NOT HEEERRRRRR!" Usopp wailed as he was dragged away.
Present Time
"…and then I got brought to the courtroom, ran into you guys, and the rest is history," finished Usopp.
"Oh man, that's rough," said Sora, looking sympathetic.
"Tell me about it," Usopp groaned. "I'm STILL not convinced this isn't all just a bad dream."
"Ah, so there WAS no sister. Just Alice!" said Luffy, grinning as he pounded a fist into his hand, having finally made the connection.
Usopp facepalmed. "And THAT'S not helping at all."
"My, my. Quite a tale, wouldn't you say?"
Everyone's heads jerked up, a look of surprise (and in Usopp's case, fear) appearing on their faces. "Who said that?" said everyone minus Usopp simultaneously.
"I-it's h-him! H-he's back!" said Usopp in a quivering voice.
"Him who?" asked Goofy.
Just then, a large purple cat's head with a wide, toothy grin that spanned the width of its face appeared out of thin air directly in front of the group, bouncing up and down as it did so, before fading back out of existence. The next second, it appeared to their left… then to the right… before finally settling on a nearby tree stump, its pink and purple striped body appearing from nowhere while standing on top of its head. The body then hopped off before grabbing the head and plopping it back on its shoulders.
The Cheshire Cat had arrived.
0o0o0o0o0o0o—Another world, several hours earlier—o0o0o0o0o0o0
"Nnggh…" grunted Sanji as he came back to the land of the living. He found he was lying on a squishy but firm surface in almost complete darkness. Sitting up, he clutched his pounding head, willing the pain away. "Geez, what the hell happened?" he wondered to himself. The last thing he remembered was a big storm over Destiny Islands, followed by the appearance of some strange, twitchy black creatures, then getting pulled down into a black vortex while Nami-san screamed for help…
NAMI-SAN!
"OOOOIIII! NAMI-SAN! WHERE ARE YOU?! ARE YOU OKAY?!" Sanji called out, but was met with silence. "NAMI-SWAN! ROBIN-CHWAN! WHERE ARE YOU?!" he called out again. Once more, he was met with silence.
I've got to find them! Sanji thought frantically as he pulled out his lighter and lit it, using it as a makeshift torch as he held it above his head. Thanks to the light, he was able to spot a pile of scrap wood nearby with what looked like some torn sailcloth on top of it. Running over, he grabbed a meter-long pole and snapped it over his knee, before tearing a length of sailcloth off and wrapping it around the end of the now shorter pole, creating a proper torch in the process. Satisfied, Sanji lit it with his lighter and began looking around.
He appeared to be in a cavern of sorts, but it was easily one of the strangest caverns he'd ever seen. The ceiling, walls, and ground were dark blue and covered with pastel-coloured blotches of a whole rainbow of colors, made of what Sanji could only assume was fungus or moss. The ground and walls also felt strangely springy and squishy, like it was made of spongy rubber. He also saw a number of bluish-green fungus croppings sticking out of the walls, and a few holes in the walls that seemed to lead to different caverns. And finally, a few piles of broken wood lay in random locations around the cave, made of what looked like ship debris and supplies. This gave Sanji pause; why would there be ship debris in a place like this?
He decided to think on it later; Nami-san and Robin-chan came first! With that, he set off to begin his search of the caverns.
After about an hour or so of searching, Sanji was beginning to get the feeling he was getting nowhere. Everything looked the same in this place! It was nearly impossible to tell the other caverns apart from each other, and he had the sneaking suspicion that he had been traveling in circles. And how would he know if Nami-san and Robin-chan were even here? The vortex could have taken him anywhere! Who was to say they weren't all the way on the other side of the world? And even if he did find them, how would they find a way out?! His frustration coming to a head, Sanji angrily kicked the nearest wall as hard as he could.
Suddenly the entire cavern shook, knocking Sanji off balance. The room then felt like it was tilting back and forth, sending the cook rolling and bouncing around like a pinball before rolling through one of the openings in the wall. After falling through a few more wall openings, the shaking and tilting settled down, allowing Sanji to get back to his feet. Getting up and dusting himself off, he took another look around to find himself in an entirely new-looking area.
He appeared to be in a gigantic cavern of sorts, with big piles of wood scattered around in what looked like a big lake. It was hard to tell how far the cavern went out thanks to the limited lighting from his torch. Upon closer inspection, the piles of wood appeared to be shipwrecks. What the hell were so many shipwrecks doing in a place like this?
"Hello out there?"
Sanji turned in surprise to the source of the voice. To his left was an older looking man in pajamas, a nightcap, and slippers, holding a lit candle. He was currently standing at the railing of a relatively intact shipwreck that appeared to have been done up to look more homely, with an oil lamp on the wall, a bed and dresser in the corner, a number of food supplies in the other corner, a table and chairs set up near the food, and what seemed to be an end table with a goldfish in a bowl set on top of it. Evidently, he had been here for a while. Sanji smiled; if he was here, maybe he knew where Nami-san and Robin-chan were!
"Excuse me, sir!" the cook called out. "Have you seen two beautiful ladies around here?"
"Ladies?" the man repeated, surprised. "No, I'm afraid I haven't. You're the only new face my son and I have seen in quite some time!" He then adjusted his glasses. "So you've been swallowed up too, eh?"
"Swallowed?" Sanji repeated, now confused. "What do you mean, 'swallowed'? I just woke up in this place!"
"Oh dear," said the man, rubbing his chin in concern.
"What's that mean?" said Sanji, getting a little annoyed. "What exactly is this… place…?" Looking a little more carefully, he noticed what looked like teeth on what he could see of the walls of the cavern, and that the ceiling had some strange wrinkles to it, almost like ribs. Couple that with the squishy, springy feeling of the ground and walls of the various chambers, and that could only mean…
Sanji rapidly shook his head in disbelief. No, that couldn't be it! There was no way! For the love of Baratie, PLEASE DON'T LET THAT BE IT!
Sanji then jumped and ran onto the deck of the ship the man was standing on and grabbed his shoulders, a crazy look in his eye.
"Old man… just where the hell am I?!"
Author's note: Hoo boy, this ended up taking a LOT longer than I expected. Much of it had to do with me getting yet another new job in the middle of December, only this one ended up having a very intense learning curve, which was why I didn't have as much energy to devote to writing. However, I managed to peck away at it bit by bit each night after work, and before I knew it, I was finished. Still, I deeply apologize for the wait.
Job challenges aside, I had a lot of fun writing this one, especially the Mad Hatter and March Hare sequence :) Hope the entire thing up to snuff.
As an aside, for the sequence directly after Usopp runs out of the tea party, Usopp didn't actually see it happen, but I still really wanted to put that bit in there, so consider it something only the reader knows about, and not the group, since Usopp didn't end up saying it to them. A bit confusing, I know, but just wanted to clear that up.
For those who spotted the 'Airplane' reference, I couldn't resist putting that in there; same for Gurren Lagann :)
Big thanks to FictionReader98 and Zoneshifter D for beta-reading this chapter!
That's all I've got to say for now. Thanks for reading, and look forward to the next one!
Usopp's story has been told, leaving only the task of finding evidence of the Heartless for our heroes. But before they can do that, the Cheshire Cat has come back into the mix! What does he want? How will the group prove Alice's innocence? And who are these mysterious strangers lurking in the forest? Stay tuned for the next exciting chapter of Heart of a Pirate!
