PoKéMoN
Avenger – by Ben Russell-Gough
Legal Disclaimer
Pokémon, the Pocket Monsters and their human friends and enemies are all the sole copyright and trademark property of Nintendo Entertainment, Game Freak Software and 4 Kids Productions. No breach of any copyright or legal property is intended.
Author's Notes
This is my first Pokémon fic. I still don't know all the monsters or the moves, so please forgive me if I get something glaringly wrong. I can only base my work on the little I've seen of the cartoon.
I want to take this opportunity to thank all the other Fanfiction.NET authors for providing plenty of information, feedback and honest advice. It has made my work much better and more satisfying to read, I think. Special thanks must go to Charles 'Rocketboy' Reilly, Wind, Chuchino, Joshua Falken and Catalina Storm for their invaluable detailed feedback.
Oh, about the Sabrina bit. I know it isn't really part of the story, but I was thinking about the character and sort of felt sorry for her. Anyway, I just wanted to showcase the character a bit. Forgive me if it spoils your reading enjoyment.
Text in [squared-off brackets] is translated Pokémon talk.
Text in Italics but not in quotes indicates thought or telepathic communication.
This is an Alternate Universe fic.
Ages: Ash is 17; Misty has just turned 19; Brock is 25; Jessie and James are both 24; Richie is 17; Duplicia is 18; Sabrina is 20; Lance is 16; Joy is 29.
Censor: R (Equivalent to UK '15' Certificate)
Content Warning: Swearing, violence and implied torture/rape
Book 2 – Team Rocket Strikes Back
What has gone before…
It is a time of conflict. Six months ago, League Supreme Champion Ash Ketchum and a band of allies formed a new band of crusading Pokémon Trainers known as 'Team Thunderbolt.' Together, these young heroes have been launching ever more bold strikes against the forces of Team Rocket, the dreaded international terrorist organisation controlled by Ash's father, Giovanni diRocketti.
Although successful, Team Thunderbolt are fighting a battle against time, trying to find the vulnerability in the structure of Team Rocket that they can exploit to destroy their mighty enemy before either the power of Team Rocket or the disturbed forces of law and order catch up with them. In the midst of this struggle, however, an unknown betrayer has acted and given Team Rocket the advantage in the war. He has betrayed Ash Ketchum, possibly the greatest Pokémon Trainer of all time into their hands.
***
Ash blinked furiously, trying to clear his vision. For some reason, his arms were above his head. He tugged and realised he was tied to some kind of overhead bar. He was standing on his feet, but his posture made it impossible to relax without nearly pulling his own arms out of their sockets.
"Wakey, wakey, hero," snarled a grating voice. A hand slapped across his face. Ash's vision cleared at last and he saw Butch and Cassidy standing there, looking excessively smug.
"Oh, you two again," Ash said in a gentle mocking tone. "Don't you think this whole thing is getting old already?"
Butch snorted. "Oh no," Cassidy said with a sadistic smirk, "we haven't even started having fun yet. Mr. Ketchum, you are now the guest of Team Rocket. Butch and I are going to be your hosts. I am sure you will find it an unforgettable experience!"
"If you are my hosts," Ash said with a grin, "then I want to complain about the room service. Additionally I hate the 'metal walled dungeon' look! It is so passé!"
"I have had enough of his lip…" Butch hissed, taking a step forward. Cassidy stopped him with a gesture.
"Ash, you are a lucky man," she announced. "For some reason, the Boss doesn't want you dead anymore. However, he does want your… attitude adjusted. That is going to be our task, and our pleasure over the next few weeks."
Ash spat at Cassidy, the only defiance that was possible at the time. Cassidy growled and wiped the spit from her face. Butch stepped forward and drove a pile driver punch into Ash's guts. Ash would have liked to fold double, but being tied at full stretch made that impossible. It doubled his pain. For a long moment he couldn't see or hear and was only aware of the agony in his abdomen.
"Enough!" Cassidy hissed. She walked forward and lifted Ash's head with a finger on his chin. "I am going to enjoy this Ash," she said. She was so close that Ash could see her maimed face very clearly indeed. "I owe you a lot of pain, Ash Ketchum, and from this moment on, I am going to pay my debts."
Cassidy drew a nasty thin-bladed knife from her boot. She used it to slice off Ash's shirt. Then she nodded to Butch, who threw a bucket of water over the young man.
Cassidy turned around. "You seem to like using electricity on Team Rocket," she remarked lightly. "Let's see if you like it in return."
Ash's eyes widened as he saw Cassidy lift up a pair of jump-start cables attached to what was probably the dungeon's power system. Held in the crocodile clips was steel wool. Cassidy brushed it together and there was a hot shower of sparks. "Do you like electricity dear?" she asked again as she stepped forward.
***
Team Thunderbolt stood helplessly, looking around at the debris of the bar. "Here it is!" Lance called. His Golem lifted the wall out of the way and Misty ran forward to pick up Ash's Pokébelt. She clutched the belt to herself and tried to think. She hadn't given any hint of her torment yet, but it could only be a matter of time.
"This is all my fault…" Gary said in a quiet and lost voice. "If I hadn't stopped off here… or if I had fought better… they would never have got him!"
"You can't blame yourself, Gary," James said gently, touching his shoulder. "They must have been planning this for weeks."
"That doesn't make me feel much better," Gary said in a bitter tone of self-reproach.
"There is no sign of him," Richie said. He had just returned from an aerial sweep on the back of Tempest, his Dragonite. "If Cassidy used her Drowzee to teleport him away, they could be on the other side of the world by now."
Misty nodded gently. "Good work, Richie," she said quietly. "Sabrina do you have anything?"
Sabrina shook his head. "Psionics aren't an exact science, Misty," she said. "And if Ash is unconscious, I wouldn't be able to detect his mind if he was sitting right next to me."
Misty nodded again, her expression unreadable. She frowned and pulled a Pokéball off of the belt. It was one she had never seen with the 'In Use' light showing. "Raichu…" she whispered. "Raichu, I choose you!" she said loudly, throwing the ball.
Raichu materialised in the middle of the wreckage. [Ash! No, don't… Oh no, he has been taken… oh no.] The little electric rodent sagged down and began to cry helplessly, all the strength going out of him in an instant.
"Raichu, what happened," Misty said.
[Misty?] he asked, looking up through his tears. [Misty, it was horrible. There were just so many of them! We fought but we couldn't win. Ash put me in my ball rather than risk me being captured.]
"Typical Ash," Gary said quietly. "Worrying more about his Pokémon than his own hide."
Misty nearly exploded. "You piece of shit!" she yelled. "This is all your fault! Now get out of here. Go to Pallet and make sure that they know how badly you've screwed up!" Gary backed away nervously. "GET OUT!" Misty screamed. Gary nearly went yellow with fear. He leapt into his car and drove away as fast as he could.
"Misty…" Joy said gently, walking forward and touching her shoulder.
"Don't say it, Joy," Misty warned.
"Don't explode, Misty," Brock said sharply. "It won't do anyone any good."
"You're right," Misty said, her voice level. "So we are going to act instead. We will interrogate every Rocket we find. We will carve open every base, every gym and every safe house. We will smash Team Rocket piece by piece until Ash is free."
"We will find him," Duplicia promised. "Besides," she added with a hollow laugh. "Knowing Ash, he is probably working on his escape now."
Misty smiled gently and nodded. The Thunderbolts began to file away. Misty held Ash's Pokébelt to her breast for a long moment before suddenly screaming out to the heavens, a lost soul.
And now the continuation…
Chapter 4 – Pain and Dreams
As Misty screamed in the ruins of the bar, the image of her torment was captured by a miniaturised digital video camera carried by a Fearow, which was soaring through the air far above her. The camera was transmitting the signal live to a pirated communications satellite some 40,000 miles above in geostationary orbit. The satellite beamed the signal down to a small island in the Southern Sea.
Once, the island had been called New Island, then, for a short time, it was know as Mew Island. No one calls it anything anymore. Indeed, most people aren't even aware that it exists. Every record, every image and every memory of the existence of this place had been purged. Are these extreme measures? Perhaps, but the new lord of this isle has come to value his privacy.
Once, Mew Island had been the home of a state-of-the-art cloning facility operated by a cover company controlled by the Team Rocket organisation. That facility, and the hapless specialists who manned it, are all gone now. In its place is a huge conical palace of black iron and glass. Look at this fortress and you will realise that there is something wrong about the place. The shapes and angles were… inhuman. Indeed, there is very little 'human' about this place. And nothing at all 'human' about its' owner.
A sophisticated computer system received the signal from the Fearow's camera and assigned it high priority out of the hundreds of thousands of signals (some from other spy cameras and some from public and private broadcasters). All of these were fed into one room: The Great Sanctum of the lord of Mew Island. There, surrounded by literally thousands of LCD TV screens, he sat, watching the affairs of the world he had foresworn, waiting for the sign.
Directly in front of his large, comfortable chair, was an image of Misty Waterflower, screaming her torment. There was no voice, but rather a presence that spoke without words into the silence of the room. Such pain, young human, the Watcher said to himself. The Chosen One is truly the other half of your soul. Can you survive without him? Should you even try?
The Watcher observed as events unfolded. Misty was stronger than many realised and she quickly took up the necessary reins of power. The power of Team Thunderbolt, such as it was, was deployed to search more effectively for its' missing leader. She is truly strong, the Watcher decided. He watched as a Team Rocket field team was quickly and efficiently captured. She, too, has great potential, should she desire to harness it. Still, hers is an impossible quest. Even as the Watcher thought those words, the captured Rockets were handed over to the Security Police. They knew nothing.
The Watcher observed for a few more minutes… or perhaps they were days? In the isolation of the Great Sanctum, time often took on new and unique meanings. No, it is not coincidence, the Watcher decided. She has a power too. I must learn what is happening and why. Joy!
After a long moment, the main entrance opened and a tall woman in a Slavic dress with kind green eyes and long red hair that hung loosely to the level of her hips entered. "What is thy bidding, my Master?" Joy Anderson, formerly the Head Nurse at the Vermilion City Pokémon Centre asked her new employer.
Joy, I need some information about Misty Waterflower, currently registered as a Trainer in the Indigo Division, the Watcher said thoughtfully. I especially require the DNA profile that was taken at her birth nineteen years ago.
"Of course sir," Joy replied smartly. "I'll have a Porygon sent to extract the data immediately." Joy was about to turn to leave, but she felt her master's telekinetic hand hold her firmly to the spot. "Is there anything else, sir?" she asked without any hint of surprise or dismay. She was used to this psychic manhandling by now.
If what I suspect is true, the Watcher said quietly, then I will be drawn to act very soon. We need to find out where Team Rocket has taken Ash Ketchum.
There was a long pause. "Sir, you know that you cannot directly interfere…" Joy began lamely.
A strange, wordless laughter filled Joy's mind, making her feel euphoric. She smiled stupidly for a few seconds before regaining control of her emotions. No, not direct interference, the Watcher announced jovially. That would be a violation of our agreement and it would be counter-productive. No there are other ways, better ways.
"I defer to your greater experience in these matters, sir," Joy said with a slight smirk. Her new boss (and probably the most shockingly sensual lover she had ever had) was a master manipulator of perceptions and minds. No doubt he would find some way to do whatever he felt was necessary without anyone even guessing who or what he was. "Is there anything else?" she asked.
Joy… the Watcher said with a smile. Please join me. He raised his right hand and beckoned his assistant over with one of his three bulbous fingers. Joy walked over and joined the Watcher in the centre of the Great Sanctum. She looked down into that strange, terrifyingly alien face. But there was truth in the saying that 'the eye is the window of the soul.' In those eyes she saw such love, such compassion and such humanity, that she was always reassured. Her master was a kind being who had dedicated his existence to the service and protection of all intelligent life on Earth, and it was a cause she had gladly adopted herself.
If she had any doubts about him or his cause, it was swept away when he healed her mind and allowed her to remember their first association. In a bizarre alternate past the one who now was a Watcher, motivated by rage, had kidnapped and enslaved her. He used her as a tool in his vicious attempt to destroy the human race. Only at the very last moment, thanks to the sacrifice of one little boy, did he see reason and find salvation. His willingness to admit to this dark past, and his utter openness about how he bitterly regretted his previous abuse of her mind and body, convinced her that this was a being she could trust. And ultimately, he was a being she could love. "Is there anything I can do for you, sir?" she asked gently, smiling down at him.
Joy, we've been working together for five years now, the Watcher said with an air of exasperation. Do you think you might see your way clear to address me by my name whilst on duty? Surely with what we have shared, you feel that comfortable with me.
Joy laughed. "I just love treating you as the 'man-of-mystery,'" she explained. The Watcher rolled his expressive grey eyes in disbelief. Joy laughed again and leaned forward to place a passionate kiss on her master's short grey snout. He responded with a telekinetic caress that made her gasp in pleasure. She stood and nodded to him. "If you prefer, I'll use your name from now on, even if it does freak Todd out."
The Watcher nodded with a rueful smile. Thank you for this small mercy, he commented. Besides, I can think of only a few things about you and me that does not freak Snap out
"Tell me about it," Joy agreed. "I'll send Porygon on his way, Mewtwo."
Mewtwo nodded thoughtfully as Joy left the room and turned back to the myriad screens from where he watched an entire world.
***
"It's no good, Misty," Sabrina said in some frustration. "They are blocking me."
"Is that possible?" Misty asked the blonde psychic in some anger.
Sabrina snorted in a good-natured fashion and looked at the two White Rockets that Lance and James had tied to a couple of trees. "Just about," she said. "If you fill your conscious-level mind with nonsense, it is possible to drown out your subconscious thought patterns. These two have been obviously trained to do that, they're actually trying to do long division in their heads." Sabrina paused and looked at one of the men. "You forgot to carry the five," she called out to him.
Misty sagged slightly. "This is the sixth washout we've had," she said to herself. "Two weeks and we are still checkmated. None of them are talking." Misty shuddered and fought down an urge to pull out her pocket knife and cut the information she wanted out of those… shits one scream at a time. She wouldn't, though. That was the way Ash's father had gone and look what had happened to him…
"Are you okay, Misty?" Sabrina asked gently. Sabrina was shocked by what she sensed next. She expected the tears tracking down the girl's face, but not the surging self-destructive hopelessness in her heart. "Don't give up, Misty," Sabrina said. "I am sure that Ash will live and that you will be with him again."
"Yes," Misty replied, "but at what cost?" All she could think of was the end of Sabrina's vision. Her and Ash, older and in a position of power, about to launch a war of conquest against the whole world. She would die before she became a thing of evil… or would she? What compromises would she be willing to make to be with Ash? Damn you, Ketchum, she shouted silently. Why does loving you have to hurt like this?
Misty whirled and fled. Sabrina was about to follow, but Brock blocked her way. "She'll be okay, Sabrina," he assured her.
"Are you certain?" Sabrina asked.
Brock smiled. "She is still shaken by all of this, but I am sure she will be all right." Sabrina nodded gently and walked away. Brock, too, remembered the shocking ending of the vision. But he was surer of the moral integrity his two friends than even they were. They would never succumb to evil. Whatever the future held, it did not involve an Ash and Misty turned to the path of darkness. At least he hoped so with all of his heart. A future where such a fall had taken place was not one he wanted to live in.
Yes, Ash would survive, Brock decided. He had to, or there was no future for the human race at all…
***
Ash screamed out loud. Around him, lights flashed and a penetrating discordant sound made his very bones shake within his flesh. The stroboscopic/sonic barrage known as the 'Armageddon Cascade' was a unique machine designed to totally overload the victim's mind and body, making it impossible to think or control your own muscles.
Ash wailed in agony as pain utterly beyond his ability to comprehend made his entire being shake. He was no longer sure of who or what he was. All he knew for certain is that he would do anything… anything to make the hurting stop. If there was a small core that still had any memory of identity, it was buried very deep and no longer could make itself heard.
If only the green-haired man and the blonde woman would return! Then he could please them and the pain would stop… oh God let the pain stop… let it stop… let it stop…
Ash wept with the agony and felt strangely relieved when he realised he couldn't control his bladder or sphincter any more. That was two less body functions to give him pain. If only it would stop…
All he had to do, the blonde one had told him, was decide to join them and dedicate his whole mind, heart and soul to their cause. All he would have to do was press the switch they had placed in his hand. Then, they promised, the pain would stop and they would take him to another place far from the pain and help him start a new life.
He wanted to press the switch… He had to press the switch, but he knew he wouldn't…
One thing stopped him. A word. He could no longer understand what it meant or why it should make him want to keep experiencing the pain, but he did know that it was the most important thing in his existence, and that was enough.
"Misty!" he screamed, his voice drowned out by random sound, as urine and liquid shit flowed freely down his legs, blood leaked from where he had driven his fingernails into the palms of his hands and the Armageddon Cascade continued to flash and roar…
***
Sabrina sagged to the ground in front of her tent and tried to force out of her mind the pain and worry that everyone in the camp was loudly broadcasting. At times like this, Sabrina very much wished to wrap herself in oblivion and never come out. The continual babble of others' emotions and thoughts made her want to scream…
Misty is really cut up about this… Hey, I can understand that, I've got a soft spot for Ash too…
I've got to keep her holding together… Ash is going to be okay, but he'll never forgive me if she comes apart…
Ash! Where are you? Please be all right…
They've gone too far… Butch and Cassidy are mine…
James, don't despair… James don't fall… James, I love you…
Poor Misty… Still how would I feel if they kidnapped Marina…? Damn Team Rocket…
Meowth… Ferget it… I don't want to be your Top Cat anymore… Meowth…
Eight into three is two… carry the two…
Brock really does care! He is a good guy after all… He handsome too… no, damn it… that was a long time ago…
'I'm Henry the Eighth I am, I am, I'm Henry the Eighth I am…'
Rai-ai… Rai-ai… Rai-ai… Rai-ai…
Sabrina really looks like she's suffering… I wish I could help…
Sabrina opened her eyes suddenly at her unexpected inclusion. Lance Hook was leaning over her. "Hey, are you okay?" he asked. He handed her a herbal tea (she never drank coffee, it made her hyper and a P15 telekinetic being hyper is not a nice thing). "I made you that tea you like, Miss Von Daimen," he continued.
Sabrina accepted the tea gratefully. "Thank you Lance, and my name is 'Sabrina,' remember?"
Lance blushed brightly. He was just a kid from the agricultural interior really, and the incredibly self-confident psychic scared the wits out of him. It didn't help that she exactly fitted his idea of a 'dream girl' and that her powers put her firmly into his 'angel' and 'goddess' categories.
"My Mom always told me that it wasn't polite to be familiar with a girl you hardly know," Lance said, averting his eyes.
Sabrina actually laughed as she sensed the waves of nervousness and suppressed attraction flowing off of the fighting-type master. "Lance, we've been fighting together for three months now, I think we definitely know each other."
"Well…" Lance said thoughtfully. "I… I don't think so, Ma'am…" he finally said. "I mean, I don't know anything about you or you about me…"
Sabrina smiled as a very kooky idea popped into her mind. She immediately rejected it as unethical and immature. She decided that she was either still stressed from trying to scan those Rockets, or that it had just been too long since she last had a date. Hey, blue eyes, she added to herself, you have never had a date, just a few guys you put in a trance while you were still trying to be a female Darth Vader. "Lance," she said out loud to the black haired boy, "it is the late twenty-first century, you know. We can be informal without getting engaged. I would like to know you, and I would like to be your friend."
"And I would like to be your friend," Lance admitted, reeking of nerves. "You are… well you are a pretty lady, Ma'am."
Sabrina blushed and came to a decision. She had got used to being lonely, but being in the camp and sometimes sensing Ash and Misty's, as well as Jessie and James's, frankly pornographic thought patterns when they made love had reawakened a part of her she thought long dead. Now there was Lance, who was sweet, strong, innocent and clearly very attracted to her. She leaned forward and touched the side of Lance's face. The boy jumped and nearly fell over, so she had to grab his arm to hold him. If you truly feel restrained because we are such strangers," she said silently, I can remedy that.
Lance's eyes opened very wide as he heard Sabrina's thoughts. Sabrina saw the elemental terror in the boy's eyes and released him with a sigh. Once again, she was just the psychic 'freak.' She was a fool to even believe anyone could overcome that barrier. "I'm sorry, Lance," she said sadly. "That was unethical of me and uncalled for. Please… please don't hate me."
Lance tried to think of something to say, but he couldn't. Sabrina turned from him and, sensing that the moment was broken, he left, leaving Sabrina behind to despair quietly.
***
Ash hung there in the torture chamber and realised that it had been quiet for some time. The Armageddon Cascade had finally ceased some time before and he had been left hanging there, covered in blood, sweat and filth. Somehow, he had survived with his identity and his resolution not to break both intact. He no longer knew how that was possible, but he was grateful.
Ash had very little physical strength anymore. Butch and Cassidy's first real act of torture was to feed him a drug that induced violent vomiting, emptying his digestive tract in record time. While he was being intravenously fed nutrients enough to keep him alive, his body insisted that it was dehydrated and starving. His limbs trembled as if he had palsy and he could no longer focus his senses enough to try and figure a way out of this.
Ash had already decided that he knew what his fate was. He would die eventually. Butch and Cassidy would eventually overdo some act of torture and his abused body would give up, or Giovanni would tire of this and have him executed. What worried him the most was that the likelihood of death no longer worried him. In fact, it would be a sweet release.
"Ash," A voice announced.
Ash looked up and tried to concentrate enough to focus his eyes. A figure stood in the room. It glowed with light as if it was an angel. Ash tried to make out the face, but it was in shadows. The figure wore a stone-coloured Team Rocket uniform. "Who…?" he said hoarsely.
"Ash, it's me…"
Ash knew that voice. "Giovanni!" he hissed. "So, why are you here? Come to gloat?" Ash's voice broke at the end of that question and he sagged, unable to even draw on enough strength to be defiant. He began to cry again.
"Actually I'm not here at all," Giovanni remarked gently. "This is a hologram. We're talking by way of a cyber-presence technology one of my legitimate organisations developed. Good, isn't it?" The hologram did a little pirouette and then laughed smugly.
"I hope you like your toy," Ash said quietly, trying to put irony and scorn into his voice as he shook all over.
"My poor little boy," Giovanni said. "You don't know how much I regret that this has been done to you. How dare your mother and my brother fill your heart and mind with so many lies and cause you such pain."
"What… what are…?"
"Ash, I am your father. I love you. I always have. And now I'm coming to bring you home. And those two… villains will never hurt you again."
"No… no they are not the ones who hurt me…"
"Ash, they have driven you and turned you into a monster!" Giovanni insisted. "You are no soldier, but they lied to you and brainwashed you into fighting a war they were too cowardly to fight themselves!"
"No…" Ash shook his head, trying to clear it and focus on what he knew to be true. That was very difficult after what he had experienced over the last agonising days… weeks… months… maybe even years. "No, they have never lied to me. Why should they?"
"They lied about me being your father," Giovanni reminded him.
That truth frustrated Ash. "They were trying to protect me!" Ash insisted, wishing he had strength enough to shout.
"Protect you?" Giovanni said with a derisive laugh. "They were afraid of you, Ash; Afraid of you and your powers. They were afraid of what might happen if I was able to help you to use them to the fullest extent."
"No… they always helped me…" Ash insisted hollowly.
"Ash," Giovanni said gently, "listen to me. You are my son, and because of this you have a power beyond that of the rest of the sheep that inhabit this world of ours. Join me, and I will help you master this power. When that happens, I assure you that nothing will be impossible for you. You will take whatever you want and no one will ever hurt you again. Do it, Ash! You are my son!"
"No," Ash grated. "I will never join you!"
"Ash, you are my son," Giovanni replied. "Your place has always been at my side. Admit that to yourself! You've always known that you were meant for a greater cause! Why would you have formed your own army of followers if you didn't think what I have done is fundamentally right! You are already Team Rocket body and soul!"
"No…"
"Ash, you and I are so alike," Giovanni said gently. "You are going to grow up just like me. My brother and your mother knew that this would happen. Why else would they have hidden you from me? You will be one who leads and dominates the lesser creatures of this world. I will teach you how to do that and how to sweep all of your enemies aside."
"No!" Ash was gritting his teeth around the pain in his heart now, tears flowing down his cheeks.
Giovanni continued as if Ash had not spoken. "Ash, as I have said, your place is at my side within the highest reaches of Team Rocket. You have that greatness that others lack. It is not something that you have a choice about. It is your destiny."
"NOOOOOOO!"
Giovanni's holographic form seemed to radiate compassion. "I know that this is a lot for you to take in, son," he said. "I'll let you think for a while. Then I'll come for your final answer." The hologram disappeared, leaving Ash to weep hopelessly in the dark and the cold.
***
"I thought I made it clear that I wanted him broken!" Giovanni shouted. Butch and Cassidy leaned away from The Boss's rage. Even though he was talking over the videophone, the threat and anger he was broadcasting filled the communications room with a physical presence that made them very frightened.
"Sir, we're trying!" Butch insisted nervously. "We're hitting him with everything we've got!"
"Well it isn't enough!" Giovanni replied. "I'm going to give you two incompetent idiots just one more day to break that damnable will of his, or you will join him in the torture chamber. Have you got that?"
"Yes sir!" Butch squeaked. Giovanni's image blinked off and Butch sagged. "We're dead," he announced. "The kid is damn near unbreakable! I thought that the Armageddon Cascade would finish him off, but somehow he is still in one piece! Electricity, beatings, psychological tortures and even audio-visual hallucinations of betrayal! He's beaten them all! Hell, he didn't even flinch when we made out we'd captured his bitch and were going to work her over too!"
Cassidy sat there, thinking. "Maybe we've been going about this the wrong way," she said. Butch shot her a strange look. "Look, if the stick doesn't work, maybe we should try the carrot!"
"What?" Butch asked stupidly.
Cassidy rolled her eyes. "Pleasure and pain," she explained. "They are more alike than many know. Maybe we can use that against him."
"How?" Butch wanted to know.
Cassidy smiled in a very dangerous way. "Leave that to me," she said with an evil laugh. "I think that I will be able to persuade Mr. Ketchum without too much effort." She rose to leave, but Butch caught her arm.
"Cassidy, remember that the Boss doesn't want him permanently damaged," he warned.
Cassidy shook him off. "Don't worry, Butch," she said, rolling her eyes in exasperation. "I'm not about to start yet. I've got to think about what I'm going to do first. No, I'm going in to clean him up. We don't want him getting an infection, do we?" Butch frowned and shook his head. He had to admit that was right, anyway. Even so, the way Cassidy laughed as she walked down the companionway made him very, very nervous.
***
Mewtwo was watching two screens of genetic code flash past far more quickly than a human eye could follow. Joy, Todd 'Snap' Marshall (Mewtwo's resident spy) and A. J. Harris (former Pokémon League Trainer and Mewtwo's in-house enforcer) stood beside their master and tried not to feel utterly out-evolved and inadequate.
There! Mewtwo replied. There it is! In response to a psychic command, the two screens stopped and backtracked a few pages. Chromosome forty-five… Ah, yes. I was a fool not to realise this before. This explains everything. Mewtwo's psychic voice was filled with triumph. It explains their bond, their abilities and even how she was able to summon him back from the dead! Now that secret lies open for my casual dissection and for such use as I see fit.
"Uh, what does it tell you, Boss?" Snap asked.
Mewtwo turned around, his face twisted with his trademark rueful smile. Chromosome 45 is the part of human DNA that governs telepsychic powers, he explained to the dark-haired photographer. I was looking for something that explained this curious bond that exists between Ketchum and Waterflower. Now I have found it.
"So they are both telepsychic?" Joy asked.
Mewtwo nodded. In a very special and specific way, he confirmed. He gestured at the screen. Tell me what you see, my friends.
Snap squinted and tried to make sense of what he saw, but it was hopeless. "Uh, it says: 'ATGGGCTTTATTCCGGTTAAACCTAGCCCGTATTT…'"
"Mew-hee-hee-hee!" The three humans were shocked. Mewtwo had actually started laughing out loud, something no one had ever heard before. No, Snap, that is just the genetic code, Mewtwo said, still laughing. Look, I can see the codes for a special kind of empathy, combined with a very limited precognition and telepathy. In essence, we are looking at the genetic basis of Mr. Ketchum's unusual ability as a Trainer as well as his unique tactical and strategic sense and his ability to lead. It is all here. It is remarkable.
"So… so what?" A.J. asked. "How does this affect our situation?"
Look again," Mewtwo advised.
"They're almost identical," Joy said with a gasp. Mewtwo rewarded her with a telekinetic pat on the head.
Correct, Mewtwo said. They both share this unique power… call it the 'Oak Variable,' after the boy's father. He was the first recorded case, after all. Ms. Waterflower's abilities seem more directed towards the empathy end rather than the tactical/leadership end, but she, too, shares these abilities.
A.J. was thinking. "It would explain a lot," he said. "It would explain how she managed to so totally take charge after Ash's kidnapping, and it would explain how she is such a natural with Pokémon and people. You spend time around her and you just feel good."
Todd nodded. "She charms as easily as you breathe. If you are hurt, she can make you feel better with just a touch and a few words."
Healing has always been a function of high-order empathy, Mewtwo agreed. This would also explain why the two are such a spectacular team.
"And it would explain why they are so important to each other," Joy added gently. "That kind of empathy would link them together. They truly are… one."
Mewtwo nodded again. Ash Ketchum is the Chosen One, the protector of our world and our futures. He is the Guardian, if you will… he announced. But Misty Waterflower's specific abilities make her Chosen in her own way… the one who allows the Guardian to maintain his humanity… the Healer… And together they are far more powerful than their individual parts suggest. They are… unbreakable…
The psychic Pokémon suddenly stood up, rising to his impressive full height. My agreement with the Maker prevents me from taking direct action, he reminded his associates. Nonetheless there is no agreement that prevents me from indirectly assisting the Chosen One in certain subtle ways. And this proves that Misty Waterflower is as much the Chosen One as her mate. Now, Snap, where is Ash Ketchum?
"Here," Snap said immediately, handing over a picture. "He's being held on diRocketti's private yacht. They're moored in Fuchsia City Harbour right now, but I'll bet they'll be heading off to Black Island soon."
Mewtwo's eyes narrowed as he considered the picture of the big, beautiful sea-going ship. Snap, I'm no expert, he said uncertainly, but I'd swear that there is something wrong about this boat.
"You'd be right," Snap replied. "It took some time, but I managed to find a few informants who were willing to talk. The ship is actually in two parts. The bulk of it is basically a barge containing espionage and fighting equipment. The front portion is actually a combat hydrofoil. I suppose that diRocketti designed it so that if he were cornered, he could escape on the hydrofoil while the barge stays behind and keeps the opposition occupied."
A.J. laughed. "Hey, just like the boat in that James Bond movie!"
"Yeah," Snap agreed. "And get this, diRocketti must be a Bond fan! He called the damn tub the 'Thunderball!'" A.J. and Todd laughed in amazement.
Mind letting me in on the joke? Mewtwo asked ironically.
"Oh, sorry Boss," Snap said. "There was a series of feature films last century about a secret agent named James Bond. A boat very like this one appeared in one of the earlier films. That film was called Thunderball too."
There was a pause. Why has no one told me about this series of feature films before? Mewtwo asked pleasantly. If there is one correlation, there may be many. I should look into it.
"Boss, forget it," A.J. advised. "It's escapist entertainment! This is just a coincidence. It isn't important."
There was a sudden psychic shock in A.J.'s head like the sound of someone snapping his or her fingers. He stood up straighter and began to sweat. I will be the sole judge of what is and is not important, Mewtwo reminded his enforcer. I want full copies of every release version of these films. I will also require career and personality profiles for all the major cast and production crew immediately.
"Yes… yes sir," A.J. said nervously. Snap was just as quick to offer the Pokémon his assurance of complete co-operation. Joy rolled her eyes at her boyfriend's over-acting and grinned behind her hand as she heard his psychic laughter.
Until then, I have a carefully limited indirect interference to prepare for. Leave me, all of you. The three humans left the psychic Pokémon alone with his thoughts.
***
Sabrina had been crying on and off pretty much all evening. She couldn't handle this herself; she needed counsel. So she released her three closest friends from their Pokéballs. "Oh Haunter, Mew, Alakazam, I am such a mess," she sniffled.
You shouldn't despair, Sabrina, Haunter announced firmly. Your own doubts do this to you, nothing else.
Haunter is right, Mew added. You should not doubt yourself so fiercely. The psychic cat's mental tone became mischievous. Besides, have you bothered to 'listen' to Lance while you are fighting? He is very nearly entranced by your movements! He is practically screaming for your company.
But… but he is terrified of me, Sabrina insisted. Everyone is! All they can see is the powerful psychic who could enslave them if she wanted to. I will never, never, be just a woman, only a thing!
If that is what you truly believe, Haunter said in a warning tone, then that is all you will ever be.
Sabrina started to cry again, and leant forward, her face pressed in her palms. Alakazam touched her head and stroked her hair like a parent soothing a child. Sabrina, I was your first, she said. When I was still an Abra, I was the only one of your band who stuck by you when madness threatened to turn you into a monster. I hoped that you would recover one day and, thanks to Ash and Haunter, you did. Now you are repaying that debt and I am very, very proud of the wonderful person you have become. Now you must be strong for yourself and beat not a physical or psychic foe, but your own demons.
Sabrina managed a quiet smile and looked up. She reached up and stroked Alakazam's soft, furry face. "I am trying, Alakazam," she replied. "But it hurts, old friend. I am so lonely and it hurts so very, very much."
"Um, Ma'am, I'm sorry for running off earlier… Please don't cry," Sabrina nearly jumped out of her skin at Lance's voice. She had been so wrapped up in her pain that she hadn't sensed his approach. Mew giggled in his mischievous psychic voice.
You could have warned me, she snapped at her Pokémon.
Why? Mew laughed. It is too much fun watching you get surprised!
Sabrina scowled in annoyance and this made Lance fret. "Uh, you are caring for your Pokémon," he said. "I can come back later."
"NO!" Sabrina almost shouted. "No, please stay, Lance. I was just thinking about something."
Lance sat down opposite Sabrina nervously. She is so… beautiful! He thought in amazement. Stop it, Lance, you are acting like a lovesick teenager… which is what I am… Oh God, what if she can hear me? Sabrina wasn't 'listening' of course. Many people feared that telepaths could hear their thoughts at all times, completely forgetting that any sane telepath wouldn't want to hear the stream-of-consciousness gibberish that was conscious thought patterns. I wonder what her lips taste of… a tiny part of Lance thought impishly.
That Sabrina-specific thought did get through and it made Sabrina feel warm. She didn't get the sense of it, only the surge of attraction. Even if it was only a crush, it was warming her heart. "So, what can I do for you, Lance?" Sabrina asked. Her voice had got lower for some reason and it made her fret. Behind her, Haunter began to chuckle in his deep voice.
"I… er…" Lance wondered how he could say this. After a moment, he shook his head and threw caution to the wind. "I wondered what you meant what you said earlier about 'remedying' us not knowing each other properly."
"Oh," Sabrina said. Of all the things he could ask, this was the one she didn't want to answer. "Well… It's technical," she said lamely.
"What do you mean?"
"Uh…" Oh what the hell, girl. Tell him already. "Well, I can create a short-lived psychic link between us that would let us share our memories and perceptions," she explained. "We wouldn't be strangers anymore and… I hope… it means that we could be friends… if you want?" Sabrina's tone became pleading.
Lance was shocked and had to think this through. "Are you saying that… that I would be in your head and you would be in mine? That we would know… everything?" Sabrina nodded and Lance was suitably amazed. "Wow, that is incredible," he said. "Let's do it!"
"No, wait," Sabrina insisted. "Look, Lance, you don't understand the consequences." Lance looked her in the eye and waited. Sabrina realised with a shock that, firstly, he was interested in this procedure, and that, secondly, he was actually listening to her. Maybe he isn't on hormone power after all, she thought. "Lance, even thought the link itself is temporary, the side-effects are permanent," she explained. "We would know everything about each other. We would share every thought, every memory and every sin up to this moment of time. We could easily become emotionally dependent on each other and could never stay sane for too long if we were forced apart."
"Well, like you said, it is the twenty-first century," Lance said in a casual tone. "Even if we don't want to stay close, we can survive."
He doesn't understand, Sabrina thought with a sigh. "Just forget it, Lance," she said.
"No, I can't," the boy said. "You see…" he paused and licked his lips. "You see, I want to know you well… and I would like to feel I can call you 'Sabrina…'"
Sabrina looked at Lance and saw only the courage and determination that made Ash include a boy who was only fifteen at the time in Team Thunderbolt. She nodded and leaned forward. She arranged her long fingers on the side of his face. She concentrated and attempted to attain to peace. She felt the undisciplined energy of Lance's mind and smiled at the innocence of his soul. When she was certain she was in, she sent him a last warning. This might be rather intense; you can still back out, she told him.
But I don't want to, Lance replied in his head. Sabrina was surprised at how clear that was… usually a non-psychic had a hard time transmitting thoughts even when in physical contact.
Very well then, she replied. She closed her eyes and gathered her power. The air went cold and Sabrina's Pokémon shivered instinctively. Your mind to my mind, Sabrina sent, gently drawing apart the barriers that shielded the depths of their minds. Your thoughts to my thoughts…One and together…
The first thought that came out of Lance's mind didn't surprise Sabrina at all. I wonder if Ash is okay, he thought.
I hope so, Sabrina replied, and then her mind screamed… there was no Sabrina and no Lance, but only a combination of the two… If Haunter hadn't dropped a 'dead air' psychic barrier over the two, everyone in the camp would have heard the cries of pain and pleasure that escaped the two young people's lips.
***
Ash looked up in surprise and then winced in pain at the light shining in from the corridor outside. "Good morning, Mr. Ketchum," Cassidy said brightly.
"Is it?" Ash asked stupidly.
"As far as you know," Cassidy replied. She walked over and looked him up and down critically. "My, you are a mess, you know that, kid?" she asked with a dangerous laugh. She leaned forward and wiped Ash's brow. "All sweaty and smelly…" she sniffed. "Hey, I think you've shit yourself! Ha! Whatever would the Scrawny Brat say?"
"She would say that you stink as a host," Ash said tiredly, trying to muster up enthusiasm for further defiance and resistance. "So, Little Miss Scar Face, what is on the menu today? Beatings, more electricity or are you just going to get your boyfriend to talk to me? His voice is torture enough."
Cassidy's expression did not change, but she slapped Ash around the face hard. "Enough talk," she snapped. She thrust her maimed face close to Ash and grinned at him in an unpleasant way. "First thing's first, you need a wash."
Ash knew a little fear as Cassidy pulled out her razor-sharp stiletto and sliced off his ruined jeans and boxers. Strangely enough, Ash didn't feel demeaned or intimidated even though he was tied up at full stretch and stark naked. After what he had been through recently, this didn't really register anymore. Cassidy picked up a bucked of water and threw it at him. She began to scrub the layers of filth off of his body with a stiff-haired brush. That hurt, but in a nice way. Ash tried to remind himself that this woman was an enemy, but his exhausted and battered body didn't want to listen. Much to his shame, it began to react automatically to the stimulation.
Cassidy looked on with an expression of amusement and lust. She smiled as best as she could with her ruined facial muscles. "My, I'm going to take back what I said!" she said. "You are no kid, you're a man, Ash Ketchum. For the first time, I'm jealous of the Scrawny Brat!"
"Her name is Misty," Ash snapped. "Show some respect you slut. She's a hundred times the woman you are."
"Really?" Cassidy asked with a quirky smile. "I wonder. Later on, I want you to tell me which of us is better." She leaned forward and licked Ash's chest. Ash's eyes opened wide in horror when he realised what was about to happen. "I think you taste of tequila," Cassidy decided. "I wonder what other tastes I'll find today." Ash tried to cower away as Cassidy reached up and began to unzip her uniform.
***
Misty was sitting in her tent, hugging Togepi and crying her eyes out when the tent flap lifted up and Meowth walked in. "Meowth! How are ya doing, kiddo?" the cat-like Pokémon asked gently in his thick Brooklyn accent.
"Badly," Misty choked. "I can't stop thinking I've failed him, Meowth."
Meowth sighed and walked up to the human girl. "You haven't," he said. "When did youse have anything to do with it? You was miles away when da bad guys got him!"
"But I should have been there!" Misty insisted with a sob. "If I'd been there, maybe he wouldn't have been captured!" Misty hid her face in her hands. "And now I can't find him, Meowth. I just can't figure out a plan to find him and help him!" Her voice began to break up into sobs. "If… if the situations were reversed… Ash would have already saved me. I… I always knew I wasn't worthy of him… not his equal… now I've proven it."
Meowth purred and rubbed his large head against the girl's face, making her look up in surprise. "Whatya talking about?" he asked. "Meowth! Youse is doin' great! Youse handled everything and got da Team movin! Even Raichu tinks you are really handlin' things well!"
"If I'm so good," she grated, "why haven't I found Ash yet?"
Meowth shook his head. "'Cause dey hid him real well," he explained. Misty looked at him in surprise. "Look, I know Team Rocket. Dey are good at this stuff, so we're just going to have ta be bettah!" Acting on instinct, he brushed a little ginger hair out of Misty's red, tear-filled eyes, making her smile a little. "Youse just need ta think about how we do dat!"
"I don't think I can, Meowth," Misty replied gently. "I'm trying, but I keep drawing a blank."
Meowth grinned. "Dat's 'cause you've been awake for da last week," he explained. "Youse need a little rest, den you'll be ready ta plan."
Misty shook her head. "I can't sleep," she replied. "Not when Ash is probably being tortured right now. I can't rest while he is hurting like that…"
Meowth shook his head. "Misty, if ya don't rest, you wont be able to help him," he told her. "Den you really will have failed. Youse gotta rest."
"I CAN'T REST YOU STUPID CAT!" Misty shouted and immediately regretted it. "I… I'm sorry, Meowth."
"Dat's all right," he said. He hated doing this, but it was obviously necessary. He stepped forward and looked into her eyes. "Youse just lean back and relax," he advised, beginning a Charm Trance attack. Misty tried to resist, but her emotional exhaustion and low energy levels were enough to make that impossible. Meowth caught the girl before she could fall. With Togepi's help, he tucked her into her sleeping bag.
[Will Mommy be alright?] Togepi asked in genuine worry.
"She'll sleep," Meowth replied. "And tomorrow?" he shrugged and the little egg-like psi-type nodded wisely.
[What about Daddy?] Togepi asked, tears threatening at the corner of his eyes.
"I don't wanna tink about dat, kid," Meowth replied. "I don't wanna tink."
Meowth left Togepi with his Trainer and walked out to join Jessie, James and Raichu. "Well?" Jessie asked imperiously.
"She'll sleep," Meowth repeated.
James nodded compassionately. "That is enough of a blessing," he said.
"James, we have to talk," Jessie said after a moment. James looked at her questioningly. "We have to make plans for what we do if Ash never comes back," she said. James physically started when Jessie said that, but she had to continue, no matter how it distressed him. "Misty can't handle it forever. You have to…" Jessie paused before continuing. "You have to be ready to take over the team."
"Ash left her in charge," James responded quietly.
"James! She's falling apart!" Jessie hissed. "She can't handle it! You are going to have to take over or Giovanni will get us all!"
"Ash left her in charge," James almost shouted. "And until he returns, she stays in charge! Got that?"
Jessie jumped back a good yard in surprise. "James," she said gently, "he isn't coming back, you know that…"
"Don't ever say that!" James shouted, grabbing Jessie by the arms and shaking her. "He is coming back! And we are going to win! Do you understand? Do you?" James grabbed her jaw in a grip that threatened to crush it and stared into her eyes with murderous anger. "Do you understand?" he roared.
"Yes, yes! Stop it, you're hurting me!" Jessie wailed. Meowth and Raichu reacted immediately. Meowth knocked James away from Jessie with a Furry Swipe attack and Raichu shocked him. After a moment, James staggered to his feet and stormed off back to his tent without looking back at his lover once.
Jessie sat there on the ground for a long moment. In all the years she and James had known each other, she had never felt closer to death than at that moment. James had been withdrawn ever since Ash had been captured, but that was now degenerating into a violent rage that filled his soul. If he were to finally succumb to the madness… "Ash," she whispered, crying in heartbreak. "Please come back… for all our sakes…"
***
Butch walked in to check up on the prisoner. Ketchum was stark naked, but that didn't immediately register in Butch's mind. It was a state he half expected, especially if he was really messy when Cassidy came to do her check up earlier that morning. "Okay, hero, rise and shine," he said in his grating voice. There was no reply.
Butch strode up and casually slapped Ash's lolling head. The boy's head tilted over to an unnatural angle, but he did not react. His eyes were open, his pupils dilated and his expression totally blank as he stared up into the corner of the ceiling. Butch swallowed a portion of mortal terror. "No," he said. "Oh shit, no. Don't do this to me you stupid Twerp!" The Boss wanted him alive and undamaged… if the kid had dropped dead, the death that would be their punishment would be lengthy and excruciatingly painful… "Come on… give me a sign here, kid," Butch said. He checked Ash's pulse and found it weak but steady. He leaned close to Ash's face and felt gentle but steady breaths stir his hair.
Butch blew out a breath in relief. "Okay, wakey, wakey Ketchum," Butch said. He grabbed Ash by the chin and waggled his head. "I said wake up!" he shouted.
There was no response. Ash's eyes had rolled out of synch and he was clearly not really conscious. Butch trembled with fear. He knew what this was. He had seen photographs of people like this in the Field Interrogation classes at Headquarters. It was theoretically possible that if you hurt someone badly enough or forced them to face sufficiently great a fear, their mind would overload and shut down to protect them from further suffering. It was technically called a Catatonic Trance. And this had apparently happened to his prisoner.
Butch was sweating freely now. Sometimes, with a lot of therapy, people recovered from catatonia, but occasionally they remained little more than vegetables for the rest of their existence. If the Boss decided that Butch and Cassidy were responsible for losing his prize prisoner to insanity… it didn't bear thinking about.
"Christ, how did this happen?" Butch wailed to no one. This morning, when he checked, Ketchum was still full of spunk, talking back to the hologram of the Boss and insulting Cassidy's maimed face. Now he was poster boy for National Brain-Death Monthly. He stepped back and examined his prisoner thoughtfully. The nakedness hadn't registered before, but it was no surprise. Cassidy had clearly cleaned the kid up well, but there was something else.
There were a series of scratches, long and shallow incisions and shallow puncture wounds all over Ash's body, as if someone had been working him over with a knife. Furthermore, the locations of the wounds disturbed Butch. Then it hit him; they were concentrated around the erogenous zones, and especially around the genitals. Butch had seen this pattern of wounds before. Indeed, he had experienced them himself. Five years ago, he had rather naively boasted to Cassidy that he could satisfy all her needs. She had taken him up on that boast and demonstrated exactly what those needs were. He still woke up screaming some dark nights…
"Oh… Oh shit!" Butch hissed. "That stupid, stupid slut! She can't keep it zipped up for a second! That fucking insane whore has gone too far this time!" Butch fled, leaving his prisoner dangling, his eyes blank and unseeing, his mind empty of everything except a lingering horror and pain that had squeezed out everything else.
***
Butch stormed into Cassidy's cabin just as she was brushing her hair after a refreshing shower. "Why Butch," she purred seductively, cocking her hips under the towel, "how can I be of service to you?"
Butch slapped Cassidy with the back of his hand, knocking her back onto her bunk. "You crazy slut," he snapped. "Do you have any idea what you have done?" Cassidy attempted an expression of wounded innocence that didn't fool Butch in the slightest. "You've practically killed him you nymphomaniac!"
"Butch, that… that isn't true," Cassidy stammered. "I'm just softening him up. Like I said, the carrot instead of the stick!"
Butch covered his face. He was so frightened of the Boss's impending wrath that it was taking all of his self control not to start being sick. "He's gone into some kind of coma, Cassidy! You haven't broken him… you've destroyed him!"
Cassidy laughed. "Don't worry, darling," she replied. "You were like that the first time, remember?" Her laugh became sadistic. "He'll come around after a few hours and I'll show him a little more. Eventually, I'll have him tied around my little finger and he will be glad to do whatever we ask. Then the Boss will be pleased and we get our promotion!"
"I think you may have gone a little too far," Butch suggested. "He's gone CATATONIC you psychopathic whore!"
"Rubbish!" Cassidy snorted. "You're just jealous."
"Jealous?" Butch almost squeaked. He couldn't believe he was having this conversation.
"Yes, jealous!" Cassidy snapped. She grinned up at him carnivorously. "And you have a right to be, Butch. He was far, far better than you are. He put up quite a fight, even though he was bound hand and foot! Can you imagine? Yes that was a sweet experience indeed, enough to keep me warm on the coldest nights!"
Butch shook his head in disgust. "Cassidy, I am not jealous of you deciding to rape him to satisfy your sickening appetites. I am just more than a little concerned with how the Boss will react to a brain-dead prisoner. The same prisoner that he ordered us to keep intact!"
Cassidy got up and slinked up to her partner. "He's not brain-dead, silly," she said. "Don't worry, I know how to get his attention." She laughed sensually. "I know how to get yours too." She reached up and used the nail on her right little finger to open a long cut along Butch's cheekbone. She leaned forward and licked the blood off with the tip of her tongue. "My big strong Butch," she whispered. "How I love your taste…"
Butch was repulsed. He shoved Cassidy back, then punched her, sending her crashing to the deck. Her towel came undone and when she rolled over she was naked, but neither seemed to notice. "Ooh, coming on strong Butchy?" Cassidy cackled dementedly. "Do you like pain? Well so do I! Let's share some now!" She lunged forward, but Butch met her face with a solid kick that slammed her back into the wall.
He backed towards the door nervously. "You've changed, Cass," he said shakily. "You've de-evolved! Since that time Ketchum's Raichu worked you over you… you've turned into a rabid animal!"
Cassidy laughed again; She was feeling an incredible rush of nearly sexual pleasure as she tasted her own blood in her mouth. "Now Butchy, don't be a stick in the mud," she giggled with a childish pout. "Join me next time… I'm sure you'll enjoy it!"
Butch had already fled down the companionway.
***
All was quiet in the camp of Team Thunderbolt. Occasionally, Sabrina and Ash's Haunters would drift by, or one of the more corporeal nocturnal Pokémon on their patrols. None of them, however, sensed the intruder who marched slowly and purposefully through the camp.
There was one person who was powerful enough to penetrate the psychic Stealth defence the intruder was using, but she was rather busy. Sabrina and Lance were currently deeply asleep, naked and tangled together in a knot of arms and legs. What they had seen inside each other's heads… well that answered all of their questions immediately. All Sabrina's mind could do was engage in a minutely detailed and repeated deep scan of Lance's incredibly open mind, trying to memorise every bit of this being who had so totally and utterly claimed her soul.
Mewtwo stopped by a two-person tent that was currently holding only one tormented soul. He reached out with his mind and sensed Misty Waterflower's terrifying dreams. Such pain, he said quietly. I once believed humans were sadistic pain givers… but now I realise if they are, it is because they experience so much terrible pain themselves. Mewtwo smiled gently and reached out. Nightmare is a powerful attack under any circumstances, and Mewtwo is a master of all things involved in the manipulation of the mind, both conscious and unconscious.
Misty tossed in her sleeping bag. Beside her, Togepi vaguely sensed the mind manipulating his Trainer's thought patterns, but in his childish innocence was ignorant of the import of these sensations…
DISCONTINUITY
Misty was standing alone on a wind-swept cliff. She was naked (as she always was in her dreams) and shivering in fear. A black sun shone, capping the waves of the vast stagnant ocean of thought with ebony light. She could feel a mind observing her as a researcher would observe some new kind of virus or bacterium through a microscope.
Who… who is there? She shouted out into the void.
Misty!
Ash?
Misty! Help me!
Misty swung around wildly, desperately searching for the source of her lover's voice. Ash… Ash, where are you? I'm trying to find you but I can't!
Help me Misty, please! I'm hurting!
Misty began to cry helplessly. Oh Ash, Ash my love, I want to find you… I'm trying but I can't. Please, whoever is listening, help me please!
Suddenly a bright light shone down. Misty turned and saw something out on the trackless ocean. A boat… no a ship. A beautiful, luxurious ship that almost made the old St. Anne look small… Somehow, she knew that Ash was on that vessel. It was there that he was being held and being made to suffer…
As she watched a massive thunderbolt illuminated the scene. A thunderbolt followed by a massive Pokéball that opened. The capture sequence dragged her forward. As she staggered towards the edge of the cliff she, absurdly, passed a smartly dressed man with black hair and eyes that sparkled with humour. "The name is Bond," he said in a thick Scottish accent, "James Bond. Look me up, my dear."
A huge aircraft with a delta wing and four powerful engines roared overhead making the cliff face crumble with the force of its' sonic boom. Misty was sent tumbling into the air and she was sucked up towards the giant Pokéball, her physical structure being converted into a laser contained matter stream for storage… Misty tried to scream as she was falling…
Falling…
Falling…
Falling…
DISCONTINUITY
Misty awakened with a shriek of surprise. "Ash!" she shouted.
The noise awakened Togepi. [What is it, Mommy?] he asked in worry.
"I… I've got to think," Misty said, ignoring the egg-like Pokémon. She could remember her dream with absolute clarity, something unusual for her. Misty put her hands to her head and thought furiously. "That boat… Ash is being held on a boat. But what boat and where? Damn it, there are thousands… millions." Misty remembered the dapper man, who might have been charming but he was sure as hell dangerous.
"Bond… James Bond," she remembered. "I know that name, but from where?" Misty thought fiercely. "Of course, a twentieth century film," she said quietly. "Brock is a fan of those and he was always showing us his favourites when we stayed with him in Pewter. He'll understand."
Misty jumped out of her tent and ran towards Brock's tent. She virtually kicked it over in her urgency. "Brock, wake up damn you," she hollered, awakening all the others in one go. "I have to find out what this clue means."
***
Cassidy stormed through the companionways of the Thunderball. She was in a foul mood after her argument with Butch. She was vaguely aware that she had done something wrong… but she couldn't figure out what it was. So what if the Ketchum kid had blown a few fuses? They were supposed to break him, weren't they? A tiny part of Cassidy Yamoto Wilkes realised that she had finally gone utterly mad. Unfortunately, her conscious self was enjoying the careless violence and indulgence of barbaric impulses far too much for that small part to persuade her to get the help she needed.
Cassidy stopped in the middle of the main corridor down E-Deck, just below the waterline and started to giggle dementedly as she considered the torments she was going to inflict on Ash Ketchum. She would enjoy it, and she had promised herself that she would make him enjoy it too. Her laughter got louder and louder. She fell against the wall, holding her sides that felt like they were going to burst. She laughed and laughed until she shouted "Shut up, damn you!"
There was a long silence. Talking to myself, she thought. First sign of madness. Ah, what the hell, being sane is overrated. That was so funny that she had to pinch herself hard to control the giggles. That felt very good, and she promised to find new places to pinch herself on her next free shift. "But first, Ketchum," she announced portentously.
Cassidy virtually slid down the main staircase to F-Deck, and walked forward to the cell where the prisoner was being kept. As she walked along, she began to sing a happy tune to herself. It surprised her to see two Dan'in armed with semi-automatic shotguns guarding the door, but not much. My Butchy, she thought, he's always the careful one. I must remember to be nice to him one day. She walked forward to open the hatch to the cell/torture chamber, but one of the guards blocked her way.
"What is the meaning of this?" she demanded.
"Sorry, Ma'am," the young terrorist fighter responded, "but this compartment is restricted to authorised personnel only."
That was such an unlikely thing to hear that Cassidy could only stand and gape for a long minute. "I think you'll find that I have authorisation," she responded, her voice cold and threatening.
"I'm sorry, Ms. Wilkes, Ma'am," the fighter repeated nervously, "but I'm afraid that you don't. Only Mr. Williams and the medics are allowed in there right now."
"What? That's rubbish," Cassidy snapped. "I'm going to see Butch and sort this out and you," here she pointed an aggressive finger at the guard, "are going to regret your impudence."
"Don't bother, I'm here," Butch said. Cassidy looked up and saw her partner standing at the top of the corridor. Two other Dan'in, also armed with semi-automatic shotguns accompanied him. "You're not allowed in there, I'm afraid, Cassidy."
Cassidy scowled at Butch and stalked towards him. "What are you talking about?" she hissed. "We've got an assignment, remember?"
"Not any more we don't," Butch replied. Cassidy saw the fear in his eyes and realised that she was not the cause. "The Boss is taking charge of Ketchum immediately. We've been recalled to Headquarters for a disciplinary investigation."
Cassidy suddenly noticed that the Thunderball's powerful gas turbine engines were running. They were already on the way. "You stupid bastard!" Cassidy shouted. "Don't tell me that you went to the Boss with your ridiculous story about the boy going into catatonia!"
"After the medics confirmed it, I had to," Butch grated. "Don't make this any harder than it has to be, Cassidy."
Cassidy lunged forward and punched Butch hard, making him reel back. She tried to follow that up with a kick to the face, but suddenly the Dan'in were all over her. A cattle prod jabbed her in the small of her back and she was sent to the floor with a scream, twitching helplessly. Before she could regain control of her limbs, a Dan'in pulled her gold-plated Colt .45" semi-auto from its' holster and two others forced her arms behind her back. She heard the 'snick' of handcuffs locking onto her wrists. "This is mutiny!" she shouted. "I'm the senior agent here, not him!"
Butch stepped forward, rolled Cassidy onto her back and, leaning over her, grabbed her by the jaw, forcing her to look at him. "Listen you stupid slut," he snarled. "We are both looking death in the face right now. If you are smart, you will do exactly what I tell you. I've told the Boss that you have had a nervous breakdown and that you can't be held responsible for your actions. If we are lucky, he will be satisfied with demoting us to the ranks and putting us on latrine duties until we die of old age."
"Forget it," Cassidy hissed. "I'm not taking the fall because you've turned chicken, Butch Williams."
Butch slapped her. "You stupid little whore," he hissed. "Don't you understand that we don't have a choice? You repeat that idea of yours to the Boss about trying to break Ketchum through rape and he will have us both staked out in the sun covered with jam for the Beedrills to eat alive!" Cassidy swallowed nervously at Butch's vehemence. "You know that he will hold me responsible for not realising you were going out of control and stopping you. And I am not about to die for you, Cassidy Wilkes, not anymore."
Butch blew out his breath and stood up, drawing a shaking hand through his hair. The two fighters who had accompanied him pulled Cassidy to her feet. "Ms. Wilkes is restricted to quarters," Butch told them. "Take her away."
"I'm going to get you for this you traitor," Cassidy snarled. "And after everything I did for you! You were nothing but a hopeless bit of cannon fodder when I picked you to replace Jessie as my partner! I made you everything that you are now."
"I know," Butch replied, "and that is why you are alive. I really ought to shoot you as a renegade, but I owe you this much." He sighed in defeat. "Cassidy, just try to stay calm. I want you to get better. When we get back to Headquarters, I'll see about getting you some help."
"I AM NOT MAD!" Cassidy screamed at the top of her voice.
"Whatever," Butch said with a shrug. "Either you get better or you get out of my way, Cass. You ever put me in danger like this again and I'll just step over your corpse." Butch turned and walked away. Cassidy was so shocked that she didn't offer any resistance as the two Dan'in dragged her back to her cabin.
Once there, they pulled off her Pokébelt, unlocked her handcuffs and then shoved her inside. Cassidy cowered on the floor as she heard the door lock behind her. If she were any normal person, she would have started crying at the very real possibility that she was going to spend the rest of her life in a Team Rocket-run asylum. Instead she got to her feet and, wearing a feral snarl, began to pace around the room like a caged animal.
***
Brock was in a foul mood. Misty couldn't blame him for this as he had just been awoken after three hours of sleep by a half-hysterical girl babbling on about a series of movies made almost a century ago. But this was important, and he was the only one who had anything even close to the knowledge she needed to solve this riddle.
Misty was standing next to Brock, who was sitting cross-legged on the ground, drinking yet another coffee. Joy was hovering close to them both, trying to stop them from coming to blows. The rest of the Thunderbolts were crowded around, roused by the noise. Some of them weren't as sure as Misty was at the relevance of this dream.
"Misty, for God's sake it was just a dream," Richie groused. "Just go back to sleep!" And let us sleep too, he added silently
Sabrina shook her head, frowning. "It wasn't just a dream," she said. "There is a lasting impression of a power here. Someone or something imposed those images on Misty's mind."
"And why didn't you detect this earlier?" Richie asked the psychic combatively. He didn't like her and he as sure as hell didn't trust her. To his surprise, Sabrina looked in Lance's direction and blushed a bright red. Aw hell, Richie thought and wished that he could just sink into the ground and never be seen again.
"She has been working hard, Richie," Lance said quietly. "Maybe she was sleeping more deeply than usual."
"Yeah, maybe," Richie said feeling terribly embarrassed.
Brock finished his fourth cup of coffee. "Okay," he said gently. "Let's start again. What did you see."
"Well, there was this boat, a very big luxury yacht, and I got the clear impression Ash was on board," Misty began. Brock nodded encouragingly. "I saw James Bond… it was the first one, the Scottish guy."
"Sean Connery," Brock supplied. He grinned impishly. "Are you sure this wasn't just a romantic fantasy?"
Misty blushed red with anger and Joy thumped Brock soundly. "Try to take this seriously, Mr. One-Night Stand," she hissed. Brock flushed angrily, but managed to turn his attention back to Misty's recollections.
"And there was this aircraft. A huge thing with a single delta wing and four engines."
Brock nodded. "That narrows it down a lot. Could it be Moonraker?" He turned to their resident experts on Team Rocket. "James, does Team Rocket have any orbital bases?"
James shrugged. Jessie looked helpless. Meowth shook his head decisively. "Nah, da Boss's never been interested in dat stuff."
Brock shook his head in frustration. "This is hopeless!" he shouted.
"Brock!" Joy hissed. "Calm down." The feeling of defeat got to everyone. Sabrina, Lance and Richie drifted away. Poor Misty looked on the verge of tears. Raichu walked up beside her and leapt to her shoulders. He stroked her face affectionately with his soft cheeks.
[You are doing everything you can, Misty,] he said. [Don't despair.]
"Was there anything else?" Jessie asked kindly. "Anything at all?"
Misty frowned. "Well… I was on a cliff," she said quietly. "There… there was a big thunderbolt, probably a reference to 'Team Thunderbolt…' and a big Pokéball…"
"Wait a minute," Brock said suddenly, standing up. "Thunderbolt and a Pokéball… why does that make me think…?" He began to pace. "Thunderbolt and a Pokéball… Thunder and a ball… Oh… oh my God I am an idiot! The boat! The Vulcan Bomber… It's about Thunderball!"
"Thunderball?" Jessie shouted, jumping to her feet. "Where did you hear that name?"
"Thunderball was the fourth James Bond movie," Brock said. "It is famed as the first one where a villain called James Bond 'Meester Bond.'" Brock thought that was funny, but no one else got the joke.
"Thunderball is also the name of Giovanni's yacht," Jessie said. "She's quite a machine, part luxury cruiser and part pirate warship. Before I started serving on a field team as Cassidy's second, I had a temporary assignment on board as a stewardess." She shuddered and leaned into James' comforting presence. "Giovanni and his rich friends had a unique idea of what classified as 'entertaining guests.'"
There was a long pause before Misty spoke. "Where is she right now?"
Richie raised a finger. "I think I might know how to find out." He ran back to his tent and emerged with his laptop computer. Within minutes he was on-line to www.ministryofshipping.gov.kto. He called up the record for the merchant vessel 'Thunderball,' registered in Cinnabar City. "The documented owner is a company called 'Red Star Engineering Inc,'" he said.
Meowth nodded. "Dat's the one. Red Star is one o' da Boss's legitimate companies."
Richie nodded. He quickly pursued the file and easily overcame the simple security locks that protected privileged information. "Okay, it looks like we have struck a jackpot here, folks," he said in an excited tone. "The Thunderball has been moored in Fuchsia City Harbour for the last three weeks. She has just put to sea this evening, but no destination was logged with the Harbourmaster's office."
"Ten will give you a thousand that they're heading for Black Island," Lance announced.
Misty stepped away, her face unreadable. "Ash is on that ship," she said with total certainty. She turned to her friends and allies. "We're going to stop that boat and rescue him. Let's get packed people. Jessie?" she turned to her friend. "I want to know everything you know about the Thunderball. Crew numbers, sensors, defensive weapons and her performance at sea if you know." Jessie nodded in agreement.
As the camp broke up, Misty walked a few yards away to gather her thoughts. Whoever had sent that dream had her thanks. It wasn't as good as delivering Ash back to her, but she could do the rest. "Hang on Ash," she said quietly. "We're coming…"
To be continued…
