Visit the Dark Angel Fans Forum at http://forums.delphiforums.com/darkangelfans to participate in Streets of Seattle and other Dark Angel projects.
STREETS OF SEATTLE
EDITION 46, 2020
To our readers: The stories appearing in today's STREETS OF SEATTLE have been cleared by the U.S. Army under the provisions of the Martial Law Declaration of 2009 and the National Emergency Declaration of 2010.
Editor-in-Chief: Jennem1
Senior Editor: DAF9
Chief Reporter: WeirdArchive
Chief Contributing Reporter: Dark999Moon
Conspiracy Girl/Mouse Goddess: 2ndmousevv
Contributing Reporter: DCRracing
Chief Financial Officer/Management Goddess: Logans_Babe
Contributing Reporter: SK452
Contributing Reporter: Melasand
Contributing Reporter: X5422
Contributing Reporter: Lucifer6lexi
Contributing Reporter: Captdonlover
Contributing Reporter: Sebastian310
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
LOCAL NEWS
SCHOOLS CONSIDER
CANCELING SUMMER VACATION
By SK452
To the horror of many students, local schools are considering the cancellation of summer vacation. I went to the school board office for their position on this matter, however they said they had no idea what I was talking about. Evidentially the news wasn't supposed to have been released yet. Something about, "causing an uproar, and undesired premature complaints."
With the school board declining to comment, I moved my investigation to a local elementary school. Upon inquisition I discovered that all of the children knew about the possibility of losing their summer freedom. Some of the older students were even in the middle of designing a revolt. However most of the kids shared the same opinion as ten-year-old Alexander who said, "If they still have school in the summer time, I just won't go. It's not like school is required anymore anyway."
With this information I became curious as to
why canceling summer vacation would be considered anyway. I decided to ask
the teachers.
"Well," said second grade teacher, Mrs. Madison, "it was our
[the teacher's] idea. We figured that the only kids who will show up
are the few whose parents force them. So we figure we get paid for
minimal work if school's in session in summer."
So there you have it then. If all the children attend school in the summer, within a week summer vacation will undoubtedly be restored. What with the teacher's evil plot being ruined and all. So kids, go to school if you don't want to go to school. And especially if you hate your teacher.
SECTOR POLICE KILL
'FREAK OF THE WEEK'
By Dark999moon
Did the Sector Police kill a real monster? Do we need to fear for our
lives because of other such crazy half humans? What really did happen to
the body of that creature? How many questions can one use to start an
article? Who is stealing my paper? The answers to these pressing
questions are:
My next-door neighbor Eddi is stealing my paper (I caught her at it,
she sells it on the black market as toilet paper then).
Five questions.
I have what looks a lot like the body of the creature and will
sell souvenir bits for $5 an ounce.
Yes
And Yes!
The vicious monster that our brave, loyal, and handsome sector
police killed was part of a privately funded program to create
horrific freaks for TV talk shows. I have this from a very reliable
source who has it from a very reliable other source who has it from
another very reliable source who heard it from
the person who was feeding the TV freaks!
However, these TV 'Freaks of the Week' as they were to be called,
have escaped and found their way onto other quality TV programming, like
the news and serious dramas. I have heard that one has even been hired to
ring the gong on the new Gong Show! Fear for your lives, fear for
your minds! These evil creatures have infiltrated TV in an attempt to
make us pay them more money when they do go on talk
shows! We will be watching these freaks on our favorite shows until
Jerry Springer Clones Limited writes a better contract for them!
So send post cards and notes to this company and get the Freaks off
our streets and out of our favorite shows!
POLICE BRUTALITY TAKES A STARTLING TURN
By LUCIFER6LEXI
Prior to the release of the transgenics, it was
considered reasonably safe to walk through the streets.
Unfortunately, this is no longer the case. The surprising thing is, this
new level of danger comes not from those sad, mixed-up animals, but from our
own police. Funny how the people supposed to protect us from danger are
always the ones we have to watch out for. When martial law was inflicted
upon us, conditions almost mirrored the current level of violence on
the street. Police everywhere, always looking to either
rip you off and/or beat you to the ground. Then a pattern emerged, if
you carried around some money, you could get off with minor little
injustices and get back to living your life.
But now we're back to square one, practically killing people in the name of the law. The only difference now is that they believe their cause is just, so money doesn't work too well in keeping them off of you. The only thing I can think to compare them to, are groups such as lynch mobs, nazi's, and your basic fill in the blank supremacists. They don't care who they beat up, as long as it's not one of them. And if someone even thinks of hitting back, well, they must be an enemy so why not just kill them? That transgenic, who beat up those cops the other day? When the full tape was shown, all I could see was the cops beating up another poor citizen who finally decided he didn't want to die. Those cops would have done the same to anybody on that street, but the transgenic, who was their main goal after all, just happened to be there, so they had a chance to make it look like they were protecting the people. I guess a point that could be made is that by the cops, we are treated the same way as these transgenics, so why don't we try and treat the transgenics a little more humanly, and maybe eventually prove that nobody deserves this kind of treatment.
ASSASSINATION ATTEMPT ON REVEREND TERRY
CALDWELL
By
DARK999MOON
Yesterday someone apparently tried to shoot the 'good' Reverend Terry Caldwell. Too bad they missed! This man has been stirring up trouble for this city since he arrived! Along with hating so called 'transgenics' he also hates Jews, Catholics, Dogs, Seagulls, People named 'Ed' and me (boy that man sure can't take a joke…light his car on fire ONCE and [deleted for profanity], I mean really). So I say please, please, please learn how to shoot a gun before you try and kill him again!
Also, his alleged attacker will be well enough to stand trial after going to the hospital after accidentally shooting off his left foot, his right ear, half of his nose, the last three fingers on his left hand, and a few other bits of himself (ouch). His only comments on why he shot at the Reverend were, "Holy [deleted for profanity]! I shot off my [deleted for profanity]! Stupid [deleted for profanity] gun!" What this cryptic message means, or why he chose the Reverend is still unknown.
SECTOR POLICE FUNDRAISER A
HIT
by
Melasand
It was a bright Easter Sunday down at the pier, in spite of the occasional shower of rain. Today marked the first annual 'Captain Don fundraiser for the Sector police, and things were certainly going well, with many visitors and a party atmosphere. Several live bands played throughout the day, food and drink were plentiful, and reasonably priced. There were several stalls, including a kissing booth run by some of Captain Don's teenage girls, which seemed to be very popular with many of the visiting Sector police, who were wandering around getting to know people. (There was almost a nasty moment when some of them ran into 'Dickie' and realized they had found the guy who beat them up, but several of the girls quickly diffused the situation).
In addition there were several games of
chance, which seemed to appeal to the men, card games and raffles. The
competition to win one of the sector passes kindly provided by the sector
police was fierce. While the women seemed to enjoy being able to just
wander around chatting, without the worry of what their children were up
to, as there were plenty of people on h
and to watch them and keep them entertained with stories and games as
well as events arranged just for them.
The petting farm was especially popular with the younger children, the favorite animals being the kittens, puppies and rabbits. Another popular event was the Easter egg hunt, which the children participated in with gusto, thought the eggs were surprisingly hard to find, having been hidden by 'Icepick', who seemed to be under the impression the children were not supposed to find them. Still all was well when several of the older girls discovered them in an old warehouse.
Medical attention was on hand for any who overindulged in the chocolate. I was lucky enough to be escorted round by the Captain himself, there was certainly plenty going on, and undoubtedly a great time was had by all, with many people expressing the hope that this will now become a regular event.
Proceeds raised by this event will be going to one of the Captains charities for the sector police.
SPACE NEEDLE
GRAFFITI DECODED
By DARK999MOON
From secret
messages to who to call for a really good time, you can find
it all on our very own Space Needle! And this SOS reporter went to
great lengths to copy down and translate all of it, well most of it.
A few of the more difficult codes are as follows:
"RR luvs MC 4evr"
"MG! LC mz's u"
"MG cant 4get u LC!"
and this cryptic message:
!!EID AHSA IED
However, this SOS reported did translate the part of a long boring
novel written on the underneath of the top of the Space Needle, in German,
by Stephen King's clone's evil twin…boy you would think that with t
hose genetics he would be able to write! I will sell copies of the
translated novel (written on old editions of SOS papers) for $4 a
piece!
Some of the more interesting messages that I have figured out
are: "Virus B!tch Goin Down" (this is obviously a code telling
to once powerful Metalhead gang where to attack next)
OC (a picture of a heart)'s D (this tells people trying to buy
blood from the black market where to look)
For a reel gode tim, cal Jimmi 1-234-567-898-7654 (though this looks like
a badly spelled version of the 'for a good time' message, really
this is telling people who buy black market films where to go, the
directions are in the 'phone number')
Not only are there multiple hidden messages, and not so hidden ones, on the Space Needle, there are also many wonderful works of art. If you look closely there is a Joshua (# 231) on the East side about halfway up. There are many unsigned works, mostly of 'naughty acts' and 'explicit genitalia'. At first I thought I had found a wonderfully done work of two people doing it at the bottom, but they ran off when I got close, so I knew they were real (and you two, I know who you are, and where you work! Also, remember, some people SLEEP on those park benches!).
I am going to keep working on those remaining messages! And why don't you all do so also? Send me a message you have decoded from the Space Needle or just your favorite bit of graffiti from it!
PUPPIES IN THE SOUP
By MELASAND
This week a local Seattle restaurant was closed down by the board of health following allegations that they were using dog meat in their dishes. Patrons of this now extremely popular restaurant have reacted angrily, saying that the meat used was obviously of a high quality, and the food served there was superb with an obvious 'euro' flavor to it. As is well known meat is increasingly hard to come by in post pulse America, so this reporter has set out to discover the truth behind this story.
As I suspected he would be, the restaurant owner was unavailable for comment, however I caught up with the manager in 'Crash' a well-known local bar. He had already consumed several glasses of alcohol. My offer to provide him with more seemed to place him in a very talkative mood. First he started by explaining to me the difficulties in obtaining fresh meat for the restaurant trade. Then he continued his story telling me about an advertisement he had seen offering quality puppy meat for sale at reasonable prices. He naturally at once set off to track down this supply of meat. After another glass of the local brew, he confided in me that he ended up at the pier, at the establishment of Captain Don, (one of Seattle's more colorful residents.) The Captain it emerged had just returned from a lengthy trip to the Philippines and had brought back with him a load of quality puppies.
NOTE (As I'm sure our readers will be aware there was a nationwide crusade in the 90's to control the pet population across America. Add to this the sudden and unexplained decline in the dog population after the pulse, and there are now relatively few native dogs in America. Therefore most dogs in America today are imported from abroad.)
By now slightly bleary eyes and slurring a little, the manager confided in me that these puppies were ones the Filipinos did not want. He looked over the puppies and found several of them had mange. (A parasitic skin condition affecting dogs, foxes, wolves, etc. It is caused by a mite burrowing under the skin and laying its eggs. This causes extreme itching in the dogs and often results in fur loss.) (While other animals and even humans may suffer from this condition, it is caused by different mites to those which affect the canine population.) In an effort to cut down on costs and increase profits the manager bought mainly these puppies for the restaurant. Thinking that a skin condition would not affect the meat. The manager continued his story, (by this time he was very drunk,) by telling me that the freshly killed carcasses were delivered to the restaurant and left in the care of the chef, who assured the manager the meat would be fine to use. However again in the interests of profit (though in this case it remains uncertain whose) some of the skin found it's way into the dishes. It was in fact this mangy skin which produced the taste sensation which so many patrons have gone wild for. They in fact believed the meat to have been cooked in an exciting new way, which gave it its so-called 'euro' flavor that they are raving about. In fact so popular is this new taste sensation that some of the ore affluent patrons have actually protested about the closure of the restaurant. It is further reported that threatening letters have been sent to the board of health.
Unfortunately before I was able to find out any more information the manager passed out on the floor in a drunken stupor and was removed from the bar. My attempts to contact him again have proved unsuccessful. Therefore in the interests of truthful and accurate reporting, this reporter intends to continue her investigations in this matter, possibly heading to the pier in the hopes of tracking down the sometimes elusive Captain Don. Hopefully I will be able to bring you more news on this story in the near future. Possibly (if I am successful in my endeavors) an interview with the Captain himself.
PIZZA INDUSTRY
SUFFERING
by SK194
Local markets currently have enormous quantities of tomatoes. The first thought of tomatoes retailers, was to give the excess tomatoes to the pizza industry. They hoped, that in return they might have gotten several free pizzas. Unfortunately though, there is also an extreme shortage of wheat. "It's crazy!" noted pizza delivery boy, Rafer. "I should just stick with being a paramedic! When you deliver crust-less pizzas, people think it's your fault and you get no tip." Then Rafer had to leave, as a huge, angry mob rounded the corner, shouting about how he ruined their pizza and 'how dare he.' Interestingly, the mob was throwing many, many tomatoes. So perhaps the huge excess of tomatoes will subside soon. Then Seattle citizens will have only to deal with the lack of wheat.
"It doesn't bother me a bit!" says the person I asked about the wheat shortage. His appearance reminded this reporter of a squirrel. "I'm allergic to wheat anyway, so it makes it much easier for me to find edible food in dumpsters."
Now I offer, the
Top 10 things to do with extra tomatoes...
10. Throw them at Rafer. (look for a very old ambulance)
9. Throw them at the mysteriously returning hover drones (but watch out
for sector cops)
8. Take them to that performance of "Cats"...
7. Make crustless pizza.
6. Use them as protection against transgenics.
5. Convert them into a power source.
4. Build a huge, red tomato snowman.
3. Paint your cardboard condo red- it'll last until it rains...
2. Have tomatoes "mysteriously" fall on your neighbor's head,
repeatedly.
1. Make a documentary about, what else, tomatoes.
PIE EATING CANCELLED DUE TO LACK OF
PIES
By MELASAND
The cancellation of the local pie eating contest has been duly noted by the residents of Seattle with much disappointment, after all how often do we get the chance of free food? Sadly there is a lack of pies available for the contest even though a local businessman offered to provide the fillings. (Well something's got to be done with all that puppy and seal; meat no ones buying) The dearth of pies is due to two basic facts.
1 Due to excessive rainfall damp grain was harvested, unfortunately this dampness has promoted the growth of a particularly nasty fungus, which has a hallucinogenic effect when the grain or the resulting flour is used, the fungus survives the cooking process and has affected several people before it was discovered. (Could this be one of the reasons for so many odd sitings in and around our fair city?)
2 Unfortunately the remaining flour from last years harvest has been attacked by weevils rendering it unusable.
Residents of Seattle are working round these difficulties with their normal stoic spirits. Appeals for flour have been made to bake the pies, and though some has been forthcoming not nearly enough for the contest has been collected. Though the collection goes on. There are several unconfirmed rumors of flour being for sale though the price is rumored to be upward of $40. Another rumor circulating is that a local businessman and entrepreneur has bought up all the pie plates in the Seattle area, why remains a mystery, maybe he just really likes pies, whatever the reason if this is true it is hoped he will make the plates available for use in the contest as organizers hope it will still be possible to stage the contest. At the moment they are looking into shipping in flour from an outside source.
Whatever the outcome we know the residents of our city are still looking forward to the contest and are honing their appetites for the big day. Hopefully it will take place in the not too distant future.
For those of you who have been unlucky enough to consume products made from contaminated flour, no there are no large eyed bright winged angels flying around Seattle, and no demons either it is all pure hallucination. On the other hand there are several Goddesses hanging out at the SOS offices who feel it is their right to be worshiped. Any offerings for these benign deities may be left at the SOS offices care of the writing staff.
DAF9 THREATENS YOUNG GIRL
By CAPTDONLOVER
In shocking allegations late Tuesday night, a girl stepped forward and admitted to receiving threatening messages from DAF9 for no apparent reason. DAF9 is reported to have warned that she was armed with "a doorknob launcher and a Civil War cannon."
"It is horrible," admits the young woman, who wished to remain anonymous. "I keep seeing them where ever I go. I think she's stalking me. And this isn't the first time, either. My boyfriend, he writes for the Streets, and he says he's got some dirt on her. I bet you there are a few bodies in her closet -- literally! I don't want to become the next one!" With those vehemently spoken words, the lass broke into tears and had to be taken away from the interview.
Police and Jenn have not answered our letters and phone calls, but we ask the general public to apprehend DAF9 and deal with this baby-scarer in the best way possible -- unrestrained mob action.
DAF9 HIRED AILING JOHNNY COCHRANE
By CAPTDONLOVER
In a shocking find, the Streets has learned that one of their own, Ms. DAF9, has hired the infamous lawyer, Johnny Cochrane, to defend herself in a trial of allegations stemming from alleged abuse and threatening notes to a young girl. What prompted this sudden hire of THE best lawyer of the 1990s? We aren't sure, but if Mr. Cochrane's previous clients are anything to judge by, it doesn't look too good for Ms. 9's innocence.
YET ANOTHER SOS SCANDAL. WILL THEY
NEVER END??
By DAF9
Those of you lucky enough to be employed probably already know about the latest government outrage to be perpetrated on all tax-paying citizens of our fair city. Yes, I'm talking about DNA testing. The staff and management here at SOS were tested last week and we were all somewhat surprised at Jennem1's ultimately unsuccessful efforts to avoid the procedure. According to Samcrazy, Jennem just doesn't like needles but the more cynical amongst us thought there might be something more to it than that. Acting on those suspicions, an anonymous reporter managed to bribe the testing company to release Jennem's results. No wonder Jennem didn't want to be tested. Turns out she is one of those Julia Roberts clones secretly created by Hollywood back in the 90's and released just before the Pulse.
So what all Seattle wants to know: Now her secret is out what is Jennem planning to do?
Editor's note: Jennem is planning to star in a sequel to Pretty Woman, and make enough to get the hell out of this dump…I mean fabulous working environment with stimulating colleagues.
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
***SPECIAL***
Do you worry how you will protect your Cardboard Condo while you are
away?
Has your guard dog been stolen? Here is a bright new idea from the
people who brought you other bright new ideas like Edible Shoes and Grow
Your Own Spouse! It's Protective Plants!!!!
Yes half flower/half beastie these plants will guard your condo
AND brighten the place up!
We have such interesting mixes as:
Rosewiler
Dandy Lion
Snap Komodo Dragon
Tiger Lily
And Many More!
Come to the Toxic Waste D...um Garden in sector 9, bring lots of things
to trade!
NO REFUNDS!
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
INTERNATIONAL NEWS
RUSSIAN GENERAL REFUSES TO LEAVE CHECHNYA
By SEBASTIAN310
When the Russian government this morning announced that a complete withdrawal of all troops from Chechnya would take place, ending 20 years of fighting in the area, it set off a jubilee among the thousands of 'Save the Chechens' activists the world over (the Chechens themselves were also head over heels about the news, quite understandably) But their celebrations were cut short because, in a furious TV address to the whole nation, the Russian general in charge of the Chechnyan campaign, Sergei Karamzin, has said he will NOT pull out his forces, vowing to fight on against Chechen partisans until the breakaway republic "reaffirms full and total Russian sovereignty over its affairs".
This astounding move has left the Russian government feeling sucker punched. General Karamzin's interpretation of his orders in Chechnya has always been famously open, but no one expected a move this brash! And just wait; it gets better! During his television address, Russian President Natasha Kournikova phoned up personally and ordered him to get his troops out of there. He flatly refused, telling her just where she could stick her orders(that bit was censored) and saying "Mother Russia is once again a great country, and I will not let her be put to shame by a bunch of flea-bitten bandits with delusions of grandeur!"
Many political analysts have suggested that the pride of Mother Russia may not be the real reason the General has refused to pull out of Chechnya. The nations of Europe have long been criticizing the Russians' track record in Chechnya, but some shady sources say that there is a healthy interest amongst them in keeping the powerful Russian army bogged down in Chechnya, healthy enough for them to consider bribing Karamzin into refusing to withdraw.
Whatever the reason, getting Karamzin out of Chechnya won't be easy. He far and away commands the best part of the Russian army, with the best equipment and the most seasoned troops. This will make it very difficult for Moscow to force him out of Chechnya, and Karamzin made it crystal clear that he will resist any armed attempts to bring his campaign to a close. The last thing President Kournikova wants is a civil war, so, for now, the solution seems to be at the negotiating table(phew!)
How well President Kournikova handles this situation will probably determine her future in the Kremlin. It also raises questions about how far the Russian generals can be trusted; and certainly casts a specter of doubt over the issue of Chechen independence.
WORLD REACTION OF TRANSGENICS
RANGING FROM HOSTILE TO
ACCEPTANCE...WITH A PRICE
By WEIRDARCHIVE
While the Federal Government and the Military Tribunal have been in the grips of the greatest witch hunt since the Red Scare, the 9-11 Terrorist Alerts, and the Dark Months Riots, world reaction to the so-called Transgenics Problem has been more mixed. From the extremes like calls for genetic testing and internment of suspected Transgenics by the French ultra-conservative party National Front to bestowing citizenship and military commissions by the rogue Republic of Alaska and the Hong Kong Independent Trade Zone, the question of the genetically enhanced at birth has been problematic to governments and religious sects alike. The following report will profile some of the most notable incidents, both in the hatred of the Manticore Breed (as some have dubbed the Transgenics) and in the begrudging acceptance from those some Transgenics have distastefully called 'Normal', as well as their own growing movements to either be considered as equals with the rest of the human race or to create a homeland for themselves and exclude 'Normals'.:
THE NORTHERN AMERICAN CONTINENT: We are all familiar with the present crisis in the US. At present, every major city and military district has been put on a Level 3 Alert due to the hostility of the Transgenics to the Sector Police and Federal authority and their desire to remain free and alive. Alas, the specter of racism, thought dealt with to some degree with the destruction of the remaining extremist session movements like Christ's Land and the Holy Aryan Empire of North America, has returned in force with some of the Neo-Luddite terrorist groups like the May 22nd Movement throwing in their support to 'cleanse the world of the Transgenic Scourge' as one unnamed member put it. This new alliance, called the Purity Brigade or the Humanity League by some, have been reported to be suspect in 150 acts of terrorism against suspected Transgenics and their sympathizers as well as some biotech laboratories and even a few non-related facilities such as solar plants and windmill preserves. Some of the most violent acts have occurred in Seattle, Chicago, New York, Portland, Los Angeles, Salt Lake City, Louisville, Atlanta, Bentonville, AR, and Washington D.C. itself. The Burning X, the unofficial symbol of the genetically pure, has been sighted as far away as the Free Mexican States, the Dallas Free Zone, Cuban-occupied Florida (which some of the Florida Liberation Front have considered to be a double symbol for freeing the area from both Cuban and Transgenics influence), Toronto, the Quebec Free State, and the Republic of Alaska. As of yet, the Federal Government have made some attempts at quashing some of the more vocal and violent anti-Transgenics groups, citing public safety and the possibility of inflaming age old racial and religious strife such as attacks on Jewish and Arab peoples. They've also cracked down on several confidence schemes related to Transgenics such as so-called blood tests called Genetic Purity Detectors where, according to the product, 'a drop of blood can tell you whether your employee or bride-to be is human or a freak' and even anti-Transgenics devices like the 'Freak-Buster' smoke bomb that is nothing more like a standard smoke grenade with coloring and incense mixed in for effect. While figures are as yet unavailable, duped and terrified citizens on such useless and potentially dangerous products have spent a rumored $10 million dollars. On the other end of the spectrum, the Republic of Alaska and Canada have been open with their granting asylum to fleeing Transgenics, despite protests from the Federal government and by their own citizens. There have been some rumors that Cuba and some of the Free Mexican States like Yucatan and Maya have been considering giving refuge to Transgenics in exchange for military servitude. As of press time, the United North American Tribes have yet to announce its position on the Transgenics until the Springtime Agenda Discussion for the Tribal Congress has been concluded. Some have theorized the unusual length of the annual meeting and deliberation is mostly due to filibusters from the Amish communities who view any modern tampering of the genetic code as sinful and by some of the Wiccan Covens who also consider Transgenics as abominations. There are also rumors of a Transgenic Nationalist movement, beginning within the polluted and inhospitable region known as Terminal City of Seattle and now gaining strength in San Francisco, San Diego, Yuma, Little Rock, Ontario, and Winnipeg. No one knows the exact platform of this movement, but calls for equality and the right to exist have been repeated through underground newspapers and pirate transmissions similar to Eyes Only by those few Transgenic spokesmen fortunate enough to escape capture. As of yet, no one in the 'Normal' community of the US has even acknowledged the possibility of Transgenic rights within the Constitution. Such discussions are prohibited by the Level Three Alert and may not be raised for some time to come.
SOUTH AMERICA: Owing to the ongoing chaos stemming from the A.B.C. (Argentine-Brazil-Chile) War, official government policy dealing with Transgenics has been sketchy at best. Rumors of Transgenics serving as mercenaries for the chance at citizenship on the winning side have been dismissed as propaganda by all the combatants involved and some human rights groups have received unconfirmed reports of specialized death camps within occupied Bolivia and Uruguay catering to their unique genetic make-up and resistance to most biological and chemical agents. The only reliable report thus far in this region was from the BBC dealing with a group of X-5s fighting off Argentine jets in a commandeered gunboat off the Falkland Islands. Their fate and destination (rumored to be Antarctica) is as yet unknown, though five jets were shot down in the melee.
EUROPE: By far, the most violent anti-Transgenic riots outside of the US have been in France, especially in Paris, Cannes, Vichy, and Calais where the pro-French National Front Party have been drumming up support to 'keep France pure', advocating the internment of suspected Transgenics for eventual deportation, and even going as far as wooing former targets of hate like the Muslim and African communities for an alliance on 'humanity levels'. Others in the European Community have been far more tolerate of Transgenics, with the Netherlands, Denmark, Germany, Sweden, Belgium, and Scotland passing proclamations allowing them to apply for citizenship in those respective countries. Italy, Spain, Portugal, Monaco, Poland, and the Baltic Countries have been less inclined to join their Northern members due to the Catholic Church's influence owing to its own stance against genetic engineering. Ireland is the lone heavily Catholic country to break from the Vatican and is considering allowing Transgenics refuge on a case-by-case basis. The Northern Irish Free Republic, Great Britain, the Czech Republic, Slovenia, Austria, Norway, Finland, and the Balkans have elected to stay neutral for the time being, only allowing Transgenics protection while they make other arrangements for transport to other countries. Switzerland, Luxembourg, San Marino, Malta, and Liechtenstein are the only countries with anti-Transgenic laws on the books. As of yet, there has been no notable Transgenic Nationalist movement here, though the National Front has been using it as a scare tactic for recruitment. Only Germany, the Netherlands, and Sweden have given some consideration to recognizing such a movement as a legitimate political force, tempering such reasoning with restraint owing to the mishaps that occurred with the Palestinians prior to Operation Jericho's Wraith.
AFRICA:
Considering its own regional conflicts, a unified policy dealing with Transgenics
in the Dark Continent is as difficult to obtain as a
cease-fire in the Congo. Depending on the country, Transgenics are
either welcomed as soldiers of fortune or ruthlessly hunted down by the
various tribal warlords or military governments. South Africa is
trying to dispel the rumor that it only seeks to give Transgenics
sanctuary in exchange for their genetic code for its own so-called
Super Soldier Projects. Its abuses with cybernetics on prisoners have
been documented by Amnesty International and the organization has been
reported in helping imprisoned Transgenics both foreign and South African
escape to friendlier shores. Only the Angolan-Namibian Confederacy has
openly recognized a proposed Transgenics Homeland and has sent agents to
court suspected members into going to their country to establish
such a haven. Whether it's an actual attempt at reconciling or a cover
for their own genetic warfare experiments is not clear.
THE UN MIDDLE EAST TRUSTEESHIP TERRITORY: This region has been suggested by members of the American Senate and the French National Front as a possible Transgenic Homeland if and when a global policy dealing with them is established. With much of the area still irradiated and contaminated with various biological and chemical weapons from the Talibans' and Iraq's attack on Israel and its own M.A.D. response known as Operation Jericho's Wraith, no normal human could realistically survive for long. Some of the major cities like Mecca, Haifa, and Basra are still very much intact with usable machinery and vehicles that could allow the Transgenics to live as much of a normal life as they did in the 'Normal' community, as some of the Relocationists have suggested. However, some of the autonomous countries within the Territory like the Turkish Neutral State, the Republic of Arabia, and the Jerusalem Free City-State have voiced strong opposition to the idea, citing the still volatile nature of the refugees still encamped in the 'Clean Zones'. In fact, the Reclaim Israel Army and Hamas have openly declared a state of war on any and all UN Peacekeeping Posts and the autonomous areas if 'one ungodly Transgenic sets foot on the Holy Land'. Understandably, there is no pro-Transgenic movement owing to the hostility from the remaining independent Muslim states in the area.
ASIA AND AUSTRALIA: Aside from the Northern American states of Canada and Alaska and certain European countries, some of the Asian countries have been the most welcoming to Transgenics...though not without controversy and conflict. Pakistan, Indonesia, Malaysia, Bangladesh, and some of the Central Asian republican formerly of the Soviet Union have followed their Muslim brothers in the Trusteeship Territory and refused to accept Transgenics though rumors of Georgia, Armenia, Turkmenistan, and Uzbekistan using them as shock troopers to quell disorder continue to surface. India, with its own Hindu and Buddhist beliefs, has shunned them as refugees, but has allowed them safe passage through the country on condition that they don't ask for asylum. Nepal, Tibet, Bhutan, and the Myanmar-Karen Alliance have given them sanctuary, thanks to their liberal policy of welcoming all undesirables. The Chinese Democratic Commonwealth is still considering whether or not to allow them into their borders, though the Hong Kong Independent Trade Zone and Taiwan have permitted some of the Transgenics to settle for the time being. The Russian Federation is following most of Europe in allowing those who are seeking asylum and have not committed any crimes against the EU. Japan has been the most open as far as Transgenics go, considering its libertarian policies and its growing 'personal artificial enhancements' community where cybernetics and Genetucking are not as actively discouraged as in most other countries. Thailand, Vietnam, Laos, and Cambodia are permitting Transgenics, but only after an intense examination and a period of military servitude. Singapore and the Philippines have been neutral thus far, though there have been some sightings of Transgenics in Mindanao and some of the uninhabited islands in the south. Australia and New Zealand are just now giving refugee status to any Transgenics within their borders and are fighting any attempt by the US government in deporting them. It's unknown whether or not they will allow Transgenics abroad to emigrate, citing a recent crackdown of a Purity Brigade recruitment cell. The Pacific Islands have largely ignored the crisis and it's not unknown how many Transgenics are out there if any, though incidents involving a group of 'Mer-people' off the shores of Tahiti, Micronesia, Fiji, and Samoa have attracted some Federal interest. Not surprisingly, Japan has the largest Transgenic Nationalist Movement in the world outside of North America with Sydney and Christchurch having pro-Transgenic groups and a sizable lobbying effort in the Canberra Parliament to give citizenship to any Transgenic seeking it.
As of yet, the United Nations has no official policy dealing with Transgenics beyond the accords dealing with prisoners and human rights in detention camps. The General Assembly is still in discussion over whether or not to even consider recognizing them as a unique sentient species or as an offshoot of the human race. Most of the secular human rights groups have lobbied for recognization while those of the religious sects have voiced concern or opposition to such action citing their respective holy testaments as guidance. The next few months will be crucial to whether the so-called Transgenics Problem will be solved peacefully or if this is the beginning of a long and bloody racial war that would cross all borders and all governments.
PRESIDENT HODGES TO ACCEPT TRANSGENIC
ESCAPEES, CONGRESS PREPARES FOR WAR
By
WEIRDARCHIVE
In a stunning move, Republic of Alaska President 'Governor' William Hodges today signed an executive order opening the rogue state's strict immigration rules to include Transgenics escaping Federal pursuit and persecution by 'Normals'. This action, along with Canada's insistence that all US forces cease all unauthorized border crossings in rounding up all fleeing Transgenics, have some members of Congress and the Military Tribunal hinting at possible war declarations for the first time since the disastrous attempt at recapturing Alaska in 2013.
Citing the recent violence against the Manticore escapees and the Federal Government obligation to 'care for its citizens, even if they came out of a test tube', 'Governor' Hodges ordered all members of the Alaskan Republic Border Patrol, which handles all immigration to the rogue state, to allow in any and all Transgenics into the state without resistance and to aid in their admission in case of Federal intervention. While the order has passed the Citizens Assembly in emergency session, some of Hodges' Cabinet have voiced concern about whether this was a wise decision owing to the present crisis in the US with mobs killing suspected Transgenics in lynches and riots reminiscent of the KKK attacks on minorities and the attacks on Muslims and Arab-Americans during the Dark Months known as 'Iraqi-bashing'. While Vice President Calvin Rutherford and Air Guard Commander 'Rocking' Billy Phillip Hayes have given their support, the leader of the Nation of Islam Reformed Samantha Adjia (the former Britney Spears) has suggested the Transgenics be kept from the general Alaskan population and deport those who had committed felonies while in flight. It is well known the Nation of Islam Reformed condemns most genetic engineering on higher forms of life, consisting it an act against Allah and His creations. Director of the Department of Law and Order Patricia Meadows also voiced concerns about the growing anti-Transgenics movement within the Republic and how Hodges' move might incite budding resentment against his administration and could be exploited by the Barrows regime. Canadian Prime Minister Joshua Arnolds praised Hodges' decision and threw his support by ordering all military bases bordering the US to confront any Federal authorities pursuing Transgenics and allowing them free passage into the country, either to settle and become citizens or go on to the Republic of Alaska or any other country of their choice. So far, there has been a reported fifteen incidents involving Federal troops and Canadian Border Guards over Transgenics seeking asylum.
With members of Congress already considering giving the Military Tribunal more authority to weed out the Transgenics, there have been those who have suggested declaring war on Canada and the Republic of Alaska for 'interfering with internal matters of safety and security'. Whether or not the military is willing or able to fight the neighbors to the North who are also members of the Bering Strait Pact, a military alliance consisting of most of the Pacific Rim and Northern European countries, remains to be seen. Some members of the Senate have voiced concern about the escalating conflict and if declaring war on Canada and Alaska would leave the rest of the country open to revolt by sympathetic forces. "We know about the budding Transgenics Nationalist Movement in Seattle." ,said one unidentified Senator. "If we start bombing the Canucks and the Eskimos, every nut job secessionist group is going to jump on this. Maybe we're better off letting the freaks run out of the country. Hell, I'd let them run all the way to the UN Middle East Trusteeship. Damn place is a death zone, anyway, and those freaks seem to handle radiation and boar germs well. They could run the place a lot better than the Palestinians, Arabs, and Jews ever did."
As of yet, the United Nations General Assembly in Toronto have only voted in a non-binding resolution suggesting all parties stand down from their present military postures and consider setting aside a homeland for the Transgenics. A resolution recognizing the Transgenics right to exist is being vetoed by several countries, owing to religious dogma and political standings against higher life form genetic creation and engineering. Another session of the UN dealing with this controversial subject has been adjourned without resolve until the next week.
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
LETTERS TO THE EDITOR
Dear Editor,
I would
like to lodge a complaint about the Sector Police Fundraiser, as one of the
so-called 'kittens' bit my child's hand off! We truly are outraged at the
fact that there were no warning signs telling not to actually pet the
creatures in the petting zoo! Also I never did get the sector pass that I
won, and my daughter seems to be missing since she went
there.
Grudgingly yours,
Sarah Sounder
SPF reply: Your daughter picked up the sector pass. Last we saw her she was heading for the Canadian border. And she took the "kitten."
Dear
Editor,
I would like to lodge a complaint abut the Sector Police Fundraiser. I had a
coupon for a free bunion massage that no one would honor.
SPF reply: Sorry, we just didn't need funds that badly.
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
CONSPIRACY GIRL
FAMILY VISITS
by CG double-oh-nuffin
Hello, my friends, it's been awhile. You may be wondering about my long absence. "Is she taking a vacation?" or "Did the clone worms get her?" has most likely been going through your mind. I'm here to tell you, neither of those statements is true. No, the truth is far more sinister than that. I've spent the past months gathering information from myriad sources (no names) on this, the grandest and most horrible conspiracy of them all! Yes, indeed, I speak of "Dunkin' Doughnuts". The Canadians are fortunate to have such a superlative source of doughnuts and sweets as Tim Horton's is. But I began to wonder, are we poor Americans half as fortunate? So I began my research. Originally it was just idle curiosity on my part, but as I dug deeper, I realized the truth!
I'm sure, my friends, that you have already guessed at the evilness
of the society conspirators plan...Yes, they are using Dunkin'
Doughnuts to control the minds of the populace. "That's
ridiculous!" you might say "It's just a doughnut shop!" Ah,
my friends, Dunkin' Doughnuts has never been "just" a
doughnut shop. From its creation, the conspirators plotted and
planned. No e-sugarcubes are allowed in Dunkin' Doughnut shops. Does this
not strike you as suspicious. For as we all know, the only way to block
the
mind-numbing rays of the clone worms is through the ingestion of
e-sugarcubes.
E-sugarcubes are tasty and go
well, very well, with coffee and doughnuts. So tell me, what reason would
a doughnut shop, if it was just a doughnut shop, have to ban them
from the premises? I could go on and tell you about the subliminal
messages in the music that is played in Dunkin' Doughnut's shops. Or
perhaps, of the hallucinogenic (sp?) substances that are slipped into their
pastries. But then you might think I'm a nutcase and refuse to listen to
the truth! So my friends, follow my advice. Next time someone you know
heads up to Canada to "visit relatives" ask them to bring
back Tim Horton's. I'll be going up to visit my "aunt" next
week.
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _
FEATURES
By DAF9
To explain to you how to determine if you or a loved one or an acquaintance or co-worker is a transgenic first I have to explain to those of you who are unfamiliar with genetics how to read a DNA sequence. DNA is made up of bases, strung together like beads on a string. There are only 4 common bases that are abbreviated A, G, C and T. The complete DNA sequence of a human being is 3,000,000,000 letters long. So get some blood from your putative transgenic and send it off to a genetic laboratory near you to have it sequenced. In a week or so you should receive back approximately 20 million pages of paper covered in a series of A's, G's, C's & T's.
Look for the following run of letters.
ATGGCTGATGAAATCAATGCCATGGAGCGTATATGTGCG(G or C or T)TAC
ATGGCCAATACCATCTGCCGTGAG
G or C or T means you can have any base but A in this position. Geneticists abbreviate this by the letter B. If your subject is a transgenic he or she should have no junk DNA. Therefore this run of letters should code for a protein. DNA sequence is read in threes: ATG GCT ….etc. We will leave the B as a B. Proteins are made up of amino acids strung together like beads. Each amino acid (of which there are 20 common ones) can be abbreviated by a single letter. There are 64 possible combinations of 3 base triplets and 20 amino acids. Some triplets translate into the same amino acid. Therefore "reading" this particular sequence of DNA MADEINAMERICABYMANTICRE which when separated out into English words Made in America by Manticre . They may be a secret government organization with the finest geneticists in the world…but they sure can't spell.
Brought to you by SOS's very own DAF9 B.Sc., M.Sc. Ph.D. who would have posted this article earlier but she had to go to her genetic code to find the appropriate triplets for each of the amino acids.
DR. LOVE
Dear Doctor Love,
I met a girl last week and we hit it off. She likes macaroni and
cheese! She is blind. I'm not quite a great person to look at so that
is a good thing. She loves my paintings too! But based on advise from my
roomy I told her I had to go back to France. Now I am heartsick. What
should I do?
Sick As A Dog With Love
Dear Sick As A Dog In Love,
Go after her you fool! What made you tell her to go away? I think
that perhaps your "roomy" was just jealous. Tell her the truth
too, not some half cocked story about deciding to stay here in the
good ole U.S. of A. Blame it all on your roommate!! :)
Doctor Love
Dear Dr. Love,
I have a serious problem. I am totally in love with myself! The problem
is that I don't love me back. I've tried everything - gifts, romance,
money! But I won't totally commit to myself. Any ideas on how I can
win me over? And if I do manage to make me love me- is it legal for
me to marry myself?
Me
Dear Me,
If I were me, I mean you, I would ask myself what it is about me that is
so goll darn wonderful? And what is wrong with me that I can't appreciate that?
If I were Dr. Love I could probably tell me what to do.
Unfortunately I'm just me, I mean... DAF9
Dear Dr. Love
I have this guy who I love and adore. I know that he loves and adores
me back. I can see it whenever he passes me in the street and I say
"hi" and he says "hi" back. Our "hi"s
are charged with sexual frustration. That's right, I've never been
intimate with my guy. I have the best photos in the world of him (he is so
damn sexy when he sings in the shower) and I've taped his breathing at
night so I can listen to it to lull me to sleep during
my frequent twenty-minute nap sessions, but we've never had sex. I'd
love to initiate the entire thing, but I can't get up the nerve to
even introduce myself to him! Any suggestions?
Dear Hormonal Overachiever
Since Dr. Love is underage I have taken it upon myself to answer
your question. The traditional cure for this age-old problem is the
COLD SHOWER, followed by electroshock therapy and possibly a prefrontal
lobotomy. Best of Luck.
C-O-N-T-E-S-T
SOS is sponsoring a contest to create the perfect herbal gummie. Submit your recipes here. Best recipe wins a three-month free subscription to Streets and an e-kiss from DAF9.
Well...you take a jumbo bag of Gummi bears, right? and then you dump 'em in a pot (a cauldron would be preferable). Then you dance around said pot (or cauldron) and chant "Double, double toil and trouble!" while tossing in additional ingredients. These include : Hallucinogenic (natural) substances (i.e., magic mushrooms), e-sugarcubes (only for the brave herbal gummie gourmet. it's not essential to the recipe though), chocolate chips, toblerone bars, butterscotch chips, caramels, and jello. then you pour it into any mould type thing (cookie cutters glued to a cookie sheet work nicely) and stick it in the freezer till they're done...then add a pinch of DA fanaticism on top to make the herbal gummis complete! 2NDMOUSEVV
first: sneak look at all competition's
recipes
next: find competition's herbal gummies
third: roll in powdered sugar (or anything that looks like it) and
try to pass off as own finally: run and hide from all
competition and hope that they don't beat you up! DARK999MOON
Okay lets see, first close all windows and
pull blinds so no one can see what you are up to. Then select your
largest pot and place on the stove, turn on the heat and start by
placing water, sugar and gelatin in the pot, next add some colorings till
you get something you like, (weird colors always sell best
to the kiddies) stir the pot to mix everything up real well, (this is
about the only time it will be safe to taste the mixture). Next
add your flavorings, those weird plant leaves you got from the
neighbor's garden just before he got hauled off by the cops would
probably be a good idea, and the fungus that was growing on the wheat has
to be good for something so that can go in too. (Now might be
a good idea to make sure your nose and mouth are covered over after
all you don't want to breath this stuff in.) Anything else that looks
good about now might be fun after all they need to look good, taste
good and have an effect.
If you messed up and tasted the mix after adding your flavorings now
might be a good idea to turn off the heat and pour the mixture into
moulds. Leave the lot to set while you open the windows and do a
check to see the cops have not realized what you are up to. (It should be
mentioned anything weird you see about now is probably the effect of the
gummies.) Once the gummies are set and you have recovered, bag them up and
take down to the pier to sell. Making sure no one knows who you are or
where you live just in case of any comebacks. MELASAND
HOW TO TELL IF
IT'S SUMMER IN SEATTLE
By 2NDMOUSEVV
The rain is two degrees warmer.
Open season on mosquitoes.
Nudist colonies migrate here.
FUN THINGS TO DO
WITH TAR
By LOGANS_BABE
Oh yes, it's that time again. The roads are getting fixed up, and you know what that means, hot tar! Due to complaints last year about the lack of creative ideas dealing with hot tar, the reporters here at SOS decided to make a list, composing of the top ideas we had.
DAF9's idea of using the hot tar as wax was the most popular. That's right girls! Don't use those old rusty razor blades anymore! Hot tar works effectively at taking off hair and even removing layers of skin!
The second most popular vote went to Weirdarchive's idea of using the tar to fill in the little holes of cardboard condos. No more nosy neighbors trying to see if you are the latest transgenic freak. No more newspapers getting stolen because your neighbors want to go to the bathroom. If they can't see in, they won't know what you have, or who/what you are!
The third choice was from our very own Jennem1. Her suggestion was to make accessories such as jewelry. Or use the tar as new bottoms for those shoes you wore out two weeks ago! Yes, this stylish footwear can make you famous with your neighbors!
For more ideas, log onto the HOT TAR ADDICTS website at Hot_Tar@@Is_Fun.com
FLU SHOTS AT
FUNDRAISER
By DCRRACING
Hello good people. Chief Hardball of the
Sector Police has informed me because of some law that I must tell you
about the free Flu Shots that most of you received Sunday at the fund
raiser. First off you received a dose of Anti-Baghdad Flu and
Mexican-Anthrax vaccine just like the sign said. The part that we
forgot to tell you about is in the vaccine was a very small "I.D.
Chip" that will stay in you body for up to 100 years. BUT WAIT!! this
Chip is a good thing! It stores
all your imported info about your life and anytime you get detained
buy the Sector people they can scan you and see your a support of the
Sector Police and this got to be a BIG PLUS!
And it will work like a credit card. Just scan and go! It may
be the only way to buy anything or pay your taxes, or Sector fines in
the very short future! But there's a little more. It seems that the "Chip" also
contains any past police record and your full medical record. So it
seem the good people of Seattle will be leaders in this chip-testing
program and if it all works out the rest of country will soon have
them. Oh and NO this is not the mark of the beast{LOL},,its just
a way to help keep the peace
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _
SEBASTIAN'S CHIP REMOVAL SERVICE
Like to rid yourself of that pesky ID chip you received along with your
flu shot? Contact Sebastian c/o Logan Cale. Sebastian has years of
experience with removing implants. Will also remove ice chips, chocolate
chips, chips on your shoulder, chips that pass in the night etc.
_ _ _ _ _ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
TV/ MOVIE LISTINGS
By
WEIRDARCHIVE
On Cineplex, Canada:
My Eyes Go Gray 9: Sex Is The Beautiful Poison, 2014, starring Natalie Portman, Keri Russell, Hayden Christensen, and Robert Patrick. Directed by Gillian Anderson. Unrated. It's hard to imagine Asia's best beloved horror series doing an erotic ghost story, though it's also hard to imagine Natalie Portman would one day forego her no nudity and no love scene pledge after playing Padme Amidala and other women who show their sensuality without disrobing. Still, at age 33 when the film was produce, Portman decided it was time to break away from the good girl and victim roles into something more edgy. Here, she shows the world what it was missing as a very sensual ghost who seduces a honeymoon couple (Russell and Christensen) into a realm of sexual delights that grow more and more intense and sinister with each moment of passion. Patrick plays an American Shinto priest who tries to dispel the spirit from literally sucking the couple dry of their essence and becoming her latest zombie lovers. Granted, Japan has had an apprehensive relationship with erotica owing to its culture (which is why this sequel of GRAY is the most Westernized version prior to Quentin Tarantino's contribution.) and Ms. Anderson tends to carry on her militant lesbian agenda a little too much with at least five scenes of women making love to each other, but this picture does do justice by giving a dark look into sex and being open with one's sensuality and fantasies while not be too preachy with staying faithful with one's spouse. Naturally, Ms. Portman holds everyone's attention with her sometimes-borderline pornographic love scenes that had Ms. Russell questioning her own sexual preferences on more than one occasion. Fans of the GRAY series usually dismiss this contribution as being the least 'supernatural' of the saga, though they haven't completely disowned it. Contains extreme sensuality, rape, S&M, and an erotic scene involving bodily fluids of an unknown origin. Parents strongly cautioned.
BANK ROBBER MAN: 2007, starring Dustin Diamond, David
Boreanaz, Eminem, and Jennifer Garner. Written by Quentin Tarantino and
directed by James Kistefer. Rated R. Some critics and fans of
Kistefer's have grouped this film with his documentary THE NEED FOR
SPEED and his first venture into fiction LEATHER CHICKS into an unofficial
trilogy because of the repeating symbols of fast cars, hot chicks, and
people who don't take BS lightly. (Often, these three films are
called the 'Road Rage Saga'. Mr. Kistefer continually denies this.)
The picture is straightforward pulp fiction (and considering
the source, it's not hard to point out the references from other
Tarantino works.) Dustin Diamond is a mid-level 'independent
operator' who joins two others like himself (Boreanaz and Eminem in his
best role to date) in the ultimate
bank robbery: A simultaneous hit on both its physical assets and its
vast electronic holdings. Naturally, things get a little out of hand
with the appearance of the FBI's best agent specializing in
cybercrime and armed robbery (Garner). While Tarantino's script does
tend to drift a little, Kistefer manages to keep the audience's attention
by pressing the budding acting skills of Eminem and play on Garner's
character who has an interesting kink to her nightlife that
is best left unexplained here. While some critics had called this
picture the weakest of Kistefer's work, fans everywhere had rented
the DVD repeatedly and made the best seller for the last decade. It's an
acquired taste, but Tarantino and Kistefer fans shouldn't be
disappointed. Contains violence, sexual themes, nudity, racial slurs,
and a few scenes of bondage and domination.
Parents strongly cautioned.
JENN TAKES JOB AT FOX NEWS IN NY
By DCRRACING
Our editor-in chief Jenn jumps ship and joins Fox. What's next DAF9 as Fox News parking valet? or Captain Don at the helm of Murdoch's yacht!
Editor's note: Like most Fox execs, Jenn was fired after less than 48 hours at Fox and returned to SOS, bringing a truckload of office supplies.
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
Fresh
Baby Seal Meat on Sale
Hello Seattle!!! for a very limited time we have freshly CLUBBED
baby seals. They're great to eat or wear. First come first served. All
your fantasies can come true! at Captain Don's by the pier, open
24/7
_ _ _ _ _ _ _ _ _ _
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _
CLASSIFIEDS
WANTED: Seeing Eye dogs. All kinds. Call Annie @555 555 576 4567
For Sale: Chewed up pencils and old rusty chains. contact Steph @ SOS
Wanted: Dancers, with summer on the way Captain Don's needs some HOT YOUNG GIRLS TO DANCE! You must be 13-18 yrs old. WILD AND HOT!!!,, ,,If this is you, come by Captain Don's by the pier and start to LIVE! Captain Don
Eyeglasses for sale. All sizes/prescriptions. Also hearing aids and glass eyes. Alley behind Metro Medical Morgue, ask for Sal.
For sale: Gently used apparel. Like new. Men's, women's and children's. A variety of sizes and styles. See Bill from "Bill's crematorium and vintage clothing emporium"
Single, attractive, professional female seeking professional male, 25-40, for long-term relationship. Enjoys dining out, old movies, books, travel. Fully human males only, please provide genetic proof.
WANTED: Men and women with loud voices needed for anti-transgenic rally to be held sometime next week. Bring your Sector Pass and one or more blunt, heavy objects. Contact the Reverend Terry Caldwell for further details.
New rare exotic pets, half friendly cat, half blood thirsty Doberman. My cat should be giving birth to her first litter soon, anyone interested in owning one of these rare pets should put their name down now, it is strictly first come first serve depending on how many she has. All types of payment considered. Apply Melasand, care of Captain Don.
FREE TO GOOD HOME: A few thousand pet cockroaches. Make great pets! Will eat anything and are d@mn near impossible to kill! Great for those who aren't good with animals! Will give away individually or as a group. Call 63258951235465 for more details!
Comment is a response to "Polygamist Wanted" classified Ad.
Polygamist Found!
Known for quite a while!
that love can be multipile
Though five is a lot
I'll try till I rot!
to bring a satisfied smile
to those I serve and beguile.
Desire to procreate?
You've found the right mate!
good and hearty genes are my lot
with strength and stamina of an ox.
Response to tommie2n1@aol.com
Thanks for reading! Visit the Dark Angel Fans Forum at http://forums.delphiforums.com/darkangelfans to participate in Streets of Seattle and other Dark Angel projects.
