Disclaimer: Don't own it…

Devin and Jack have struck again! How will Wes, Eric and the Rangers take it? Jack and Devin finally meet up, and their plans clash, endangering one of the Time Force Rangers…

This chapter will be short, as to I am building up for something big…

The Time Code, part 1

Eric panted as he scrambled up the stairs. "Wes!" he yelled. He saw Jen standing there, a look of awe on his face.

"What is it?" Jen said. Eric shook his head.

"There's been another murder." He said solemnly.

Lucas gasped. "No."

Jen looked at him, a look of disbelief ran across her face. She jumped towards the computer. "Scotts to base, Scotts to base!" No answer came. "Damn it, some one come in, someone!" Again, no response came.

"You guys keep looking for them, we'll go check it out and see what we can find." Wes said. He looked at the Rangers and left, unsure how long they'd be apart for.

Later—9:15PM

Wes sat at him computer and tried to make sense of the data. "There's no pattern. Devin and Jack are just killing them at random. No motives, no nothing."

Trip came up behind the Red Ranger. "Tell me about it." He sighed. "Even Time Force is stumped by it. They don't have any reason for killing those women, they just…do."

"Anything else you can think about, Trip?" Eric asked. He too was stumped.

Trip shook his head. "Nothing. All I can think of doing is going over our information again and try to figure something else out."

Lucas and Katie walked into the lab with some cups of coffee. "Anything?" Lucas asked hopefully.

"Not a damn thing." Wes said. "We're at a dead end.

Katie handed him a note. "If this helps at all, I found this." She handed Wes the piece of paper. Letters were written on it:

GATTACTACCTGACTAGGGATTTCATTAGGATGACCATGAGTTACTTACCGTA…

Below that was another number:

031905: 0000:00

"Someone was probably playing hangman." Eric muttered.

Trip recgonized the letter immediately. "It's a genetic code! GATTACT, its the DNA of the next victim!" He jumped at the computer and began a search for the victim.

Wes smiled and slapped his shoulder. "Good work, Trip. Now, lets save someone."

In the park

Jen sighed heavily as she walked in the moonlight's path. So much had happened. First Devin escaped, now Jack. Those two were a deadly combination. Another woman was the cause of her loss of concentration. Another woman was dead because she failed to find them.

She sighed. She had to get away from the chaos and just take a walk. There was a lot on her mind. Devin and Jack, the murders, and Wes. How long would their happiness last?

Jen looked up at the moon, as something flew by her ear. Her quick reflexes grabbed the card and she read it.

I'll give you one chance, a battle between you and me. I know you can't resist this, Captain. I know you all too well. Like I said before, this is your one chance to capture me. My brother doesn't know about this. Meet me at the warehouse on Springstein and fifth at 12am.

Come alone…

Jen looked around for Devin, knowing this was from him. He wanted to meet her for a fight and end this.

"I'll see you at twelve, then." The Captain said. She made her way back home to change.

Back at the lab

Wes ran the letters through the computer twice over. Nothing came up for the next victim. He sighed.

"Wes, maybe you should take a break." Katie suggested.

"No, not until I find this guy. I don't want him to kill someone else that I love." He said.

Katie gave him a strange look. "What do you mean by that?"

The Red Ranger sniffed. "That last woman they killed before…" he let out an unsteady breath. "She was my aunt."

"Oh, Wes." Katie placed her arm around him. "I'm so sorry."

He sighed. "Thanks. I just want him stopped."

Eric walked back in with a pizza. "Come get some dinner, Wes." Eric said.

Wes began another search for a possible answer as he sat down and began to eat. But none came. He sighed as they went to the kitchen dinner.

The minute after they left, the computer beeped.

NEXT VICTIM IDENTIFIED

11:30PM

Jen hadn't contacted Wes in hours, and he was getting quite worried.

"Jen, come in. It's Wes." He said over his morpher. Nothing came back. "Jen?" he said again.

"Relax, Wes. She's probably out shopping or something." Eric said. Wes rolled his eyes.

"He's probably right,' Lucas followed.

Katie, however, had a different thought. "Jen just wouldn't go out shopping when we have a killer on the loose," she said. "nor would she go without me."

A small chuckle came from the guys as Trip got up to go check the computer. The screen blinked as the Green Ranger sat down besides it. His grin was soon replaced with fear.

He began to type furiously at the computer. "Please, let it be wrong!" Panic rang out through this voice. He jumped up and ran back into the kitchen.

At the warehouse

Jen parked her motorcycle in front of the warehouse and turned off the engine.

"Last battle, Devin. You can't escape from me now," she muttered. Slowly and cautiously Jen crept up the stairs to where Devin sat and waited.

"That's right, Captain." He muttered evilly. "Come up and try and stop me, I have a little present for you." A flash of lightning lit up outside, and reflected off of a long butcher knife. "You're going to die from surprise."

Back at the lab

"Guys! Guys, come quick!" He yelled, his eyes scanned the screen for a flaw. His fellow rangers footsteps were heard scrambling into the room. Trip jumped up.

"What's wrong, Trip?" Lucas said, noticing the panicked look on his friend's face.

"The next victim of Devin's, I discovered her…" Trip said. Lucas shook him.

"Spit it out, who is it!" Lucas screamed.

Wes's eyes were glued to the screen, his eyes went wide. "No…" he whispered. The same material from the letter Katie found was on the computer, as well as a date and time:

GATTACTACCTGACTAGGGATTTCATTAGGATGACCATGAGTTACTTACCGTA…

03/19/05: 12:00am

The name of the victim blinked under that, each ranger was silent, not moving a muscle. The blinking seemed to grow with noise and blocked out every sense. Wes's eyes were glued to that person's face, who was going to be killed by Devin within the next half hour:

Captain Jennifer Scotts…