Fakemon Dimensions Part 3!!!
The plane landed...
When the players came out they looked around and saw so much space, it was a huge, diverse land.
"Welcome... To the Galor Region! We are exactly in The Wild Area! Your challenge is simple, you are all given masterballs, catch the legendary pokemon when you see it to guarantee yourself a full heart but you must do it quick~ Now go!" Mew yelled.
The players began looking around the wild area and there they saw the legendaries.
"Why are we here." Asked Regidrago.
"Idontknowbutwebetterthinkfastaboutitorsomethinghehehehe!" Said Regieleki very fast.
"Mew is my ex girlfriend, so I bet she is totally still in love with me." Calyrex told them.
"Sorry mate, but she won't go back with you. Mew ditched all of us after she won The Arceus Competition. She herself said she was so much better than any other legendary that she didn't need you as her lackey anymore. She doesn't care about you." Regidrago told him
Calyrex sighed "I'm not an idiot... deep inside I know she was just using me to get farther in the game..., but... I also deep inside know that she did love me..." He smiled.
Spectrier and Glastrier did horse noises.
"Sure Mew is snobby, cocky and rude but she's also a 10th level hottie!" Calyrex smiled.
"I wouldn't say that." Regidrago looked away bored.
"Plus she started as a quiet, calm and nice chick, I know she's still nice and she-" Then Calyrex was sucked into a ball.
Gasps
"What the hell you stole my throw!" Magby glared at Totodile.
"Gua, gua gua guaguagua gua." She told him looking bored.
"Holyfuckingshititsanambushorsomethingrunnnnnn!!!!" Regieleki talked very fast.
Dusclops ghostly appeared behind him and threw his masterball.
The Legendary Horses did Horse noises and ran around.
Flygon flew after them but Solrock stopped Glastrier from moving and then threw her masterball at him.
Dark Musharna teleported in front of Flygon, shot him with Psychic which made her lose 0.5 HP and then catched Spectrier.
Only Regidrago was left.
"Stop! W-what are you all doing!" Regidrago looked scared.
Druddigon catched him.
"So you all earn one full heart for catching a pokemon!" Mew smiled.
It meant Druddigon, Dusclops and Solrock, now had 5 P
Dark Musharna had 6 HP
and Totodile had 7 HP!
"Dayum gurl you got them HPs!" Togepi nudged her. Totodile grinned.
Pumpkingking snapped his fingers and all the players were teleported.
"You are now in the bottom south entrance of the Wild Area, you must RUN not fly or levitate, RUN ON FOOT all the way to The north side of the wild area, whoever reaches last will face automatic elimination." Pumpkingking grinned.
Druddigon raised his hand.
"Yes red bluey boi" Pumpkingking smiled.
"Um, can you help people who can't fly or levitate?" Asked Druddigon.
"Meh, knock yourself out, I don't care." Pumpkingking shrugged.
"See Solrock and Mothim, you two will be fine I got you." Druddigon smiled.
Mothim and Solrock looked happy as they stopped flying and levitating.
Mothim was holding into one of Druddigons wings, While Druddigon carried Solrocks heavy rock body. "Don't call me fat." Solrock glared.
"What do you even eat, Arceus!" Druddigon struggled to carry her.
"Can someone carry me... help... hellooo?" Dark Musharna frowned. As everyone ignored her.
"I'm kinda slow.." Alcreamie frowned.
"Don't worry friendo, ride on my back and I'll carry you to the finish line." Sylveon smiled.
Alcreamie was happy, she jumped on Sylveons back.
Sylveon (Team Z): "Alcreamie and I share a lot of similarities, we both love trends, fashion, making money and also sex! Alcreamie and I have bonded a lot these past few days, you know just talking between challenges, I hope I can help her out as much as I can." She smiled.
Alcreamie (Team Z): "Sylveon is such a nice pokemon! She helps me a lot and well I been a fan of her for a while too, she is known throughout the regions as the most popular prostitute ever, even surpassing grand sex queens as Lopunny and Gardevoir! Sylveon is an amazing role model for me and I really hope I could join her prostitution company if I don't die." She smiled.
"So what do we do now?" Asked Wooloo.
"Sing and RUN NOW!" Mew giggled
(Music Playing: Sword and Shield Battle Tower Boss)
Eva: "Come on everyone"
Psyduck: "we're so close, to the end"
Togepi: "so grab a friend and run forward"
Druddigon: "with valor!"
Flygon: "Half way through this game"
Mothim: "...just endure a bit more pain!.."
Wigglytuff: "and the Wish i will gain~"
Wooloo: "as we finally reached the grand region..."
Kangaskhan: "of Galor!"
Lucah: "Come on everyone let's go-"
Foe: "we reached Galor!"
Ludicolo: "So let's keep running ahead!"
J4N-R: "lots of Valor!"
Eiscue: "We're more than half way done~"
Alcreamie: "let's not give up!"
Sylveon: "as we keep close the ones we love"
Flareon: "ugh.."
Yamper: "look at everyone running by our sides, isn't this such a beautiful sight?"
Toxtricity: "I dont really care as long as they dont get in my way, otherwise I'd snap their heads~"
Seismethtoad: "run to our goal"
Krookodile: "a 20k mile run to our safe chill zone!"
Vespiqueen: "hold the phone"
Magby: "..one will die, if they reach last.."
Gardevoir: "So dont stop sprinting and run with valor!"
Mew: "because~"
Everyone: "We reached Galor!" x4
Pincurchin: "Welcome everyone"
Solrock: "...we're so close, to the end..."
Joltik: "so grab a friend and run forward"
Seismethtoad: "With valor!"
Dusclops: "Half way through this game"
Magby: "Just endure a bit more pain!"
Vespiqueen: And the Wish we will gain~"
Numel: "This mini challenge is so plain.."
Lucah: "So let's all not give up!"
Crack-A-Chu: "We will win today!"
Flareon: "as we finally reached the grand region..."
Sylveon: "of Galor!"
Alcreamie: "Come on everyone let's go~~~"
Flygon: "We should all be grateful we managed to-"
Druddigon: "-Reached Galor!" x3
Gardevoir: "So let's keep running ahead~"
Eiscue: "with lots of Valor!"
Yamper: "We're more than half way done~"
Psyduck: "let's not give up!"
Dark Musharna: "we're close to the end~"
Togepi: "Look how hard everyone is working friends!"
J4N-R: "Let's just keep running fast and steady!"
OOM: "We're 15k miles finished already!"
Makuhita: "and we will soon end this baby! Yeah!"
Pincurchin: "Just keep running ahead!"
Druddigon: "We are All-Star Players, Let's use our Ace!"
Dark Musharna: "The Last One will die in this Place!"
Wigglytuff: "So we literally, Can't Lose This Race!"
All The Contestants: Welcome everyone! We reached the grand region of Galor! So let's keep racing for 4k Miles with lots of Valor!
Magby: "My legs feel like they're breaking in half!"
Makuhita "There is so much sweat in my eyes!"
Totodile: "GUA GUA GUAGUA GUA!"
All: "We must pull through and keep racing because the last Placer dies!"
(Song end)
The contestants had been running for 18k Miles.
"I am so tired!" Magby whinned.
"We are so close Magby look over there!" Gardevoir pointed.
Sure enough, the goal was visible.
Sylveon, Flareon and Alcreamie reached.
Toxtricity, Krookodile, Totodile also reached.
They all looked shocked as they saw Stonjourner reached first before all of them.
Seismethtoad and Joltik came then, Joltik was on top of Seismethtoads head.
Dark Musharna kept shooting psychic blasts at the grounground trying to push her ahead.
Wigglytuff ran and reached, Psyduck came afterwards.
Crack-A-Chu, Yamper, Wooloo and Eiscue also finished.
Same with Vespiqueen, Numel and Dusclops.
Eva, Ludicolo, J4N-R, OOM and Makihita then came.
"Boss, i am so tired, let me catch my breath..." Makuhita was sweating laying on the ground and panting.
OOM was panting and holding a small sea urchin. "I thought he looked cute!" OOM smiled.
"Ugh, back in my day sex dolls were made from plastic and silicone, not titanium steel!" Pincurchin complained about OOM.
Druddigon reached tiredly. He also made Mothim, Handy and Solrock win.
Gardevoir and Magby reached the goal.
with Kangaskhan, Foe, Lucah, Togepi and Flygon finishing the race that only left on the race.
"Dark Musharna is automatically eliminated!" Pumpkingking smiled.
"What this challenge was completely rigged against me! What the hell!" Dark Musharna yelled.
"See Ya Hun Mun!" Druddigon flipped her off.
Dark Musharna started levitated and charged towards Druddigon, but then Pumpkingking snapped his fingers and she died as she was electrocuted and burned alive.
Her lifeless corpse layed on the floor.
"K anywho lets continue with the challenge!" Pumpkingking snapped his finger and teleported everyone away.
Leaving Dark Musharna dead and alone...
(Galor Region - Wyndon Stadium)
When the contestants looked around they saw they were all in a huge fucking stadium and a lot of different pokemon were spectating and cheering for them. The players looked around amazed and surprised at the viewers watching them.
"Welcome to your next challenge, Stadium Audeathtorium!" Mew announced.
"You really gotta stop rhyming things... it makes you sound more dumb than usual..." Solrock looked bored.
Mew growled and then continued.
"So this challenge is quite simple, we will place you in groups in which battleing each other will be fair, then you shall beat up your enemy until one loses one life, aka suffer a usually fatal attack!" Mew smirked.
Gasps!
"That's insane! We arent gonna battle our friends if we get grouped with them!" Druddigon yelled.
"Welp then you will BOTH lose Two lifes as a punishment, hahahaha so you choose, kill your enemy and win immunity, or spare them snd suffer a painful demise!" Mew grinned.
The players looked scared.
"Whoever wins will be then placed to battle again other similar winners! And then we will give immunity accordingly." Mew smiled.
"You're sick sheila." Lucario glared.
"Eh, i've been called worse..." Mew shrugged.
Then out of nowhere the floor under Togepi and Flygon quickly started to glitch and they were both sucked into a portal.
Nobody even had time to react as the portal quickly closed.
silence
then screams.
"What the hell was that!" Mothim was shaking.
"Um, A Time Space Blast." PumpKingKing told them.
"what the... what the hell is a Time Space Blast!" Yelled Crack-A-Chu
"Bruhhhh I literally just explained it to you all, this season on chapter 74!" PumpKingKing was holding a book that had the word MNA-SLWT in the title and pointed at the sentence in which he explained what a time space Blast is, he then threw away the fanfic book like if it was worthless, although he wasn't far off.
"Apperantly a Time Space Blast is when Time and Space is breaking." Psyduck explained the people around her.
"Indeed, this time line is dying cause it's a non cannon timeline trying to become a real dimension! So there might be a tad few glitches and deadly bugs around here somewhere.." PumpKingKing shrugged.
"What will happen to Togepi and Flygon?" Asked Yamper
"Um, idk, but if they dont come back until the episode is over, they're automatically eliminated! Now lets pair you people up into groups to start that battle tournament!" PumpKingKing smiled.
A few hours later for the writer of this story to figure out what's the perfect battling bracket to make all fights balanced, however for you it was only a few seconds until the story continued...
The players looked up to see the big screen.
Rounds:
Oom vs Lucah
Numel vs Yamper
Joltik vs Flareon
Seismethtoad vs Sylveon
Vespiqueen vs Makuhita
Wigglytuff vs Krookodile
Kangaskhan vs Ludicolo
Crack-A-Chu vs Eva
Pincurchin vs Handy
Wooloo vs Totodile
Alcreamie vs Foe
Magby vs Eiscue
Druddigon vs Toxtricity
Dusclops vs Solrock
Mothim vs Stonjourner
J4N-R vs Psyduck
Gardevoir just had a pokerface as he sat on the bleachers.
"Wait, this is just the battling challenge we did in Unova on the Battle Subway!" Druddigon spoke.
"It sureee is! But now you will lose lifes which can be deadly, imagen the ratings haha!" Mew cheered.
Frowns.
"Oh one more thing before you start battling." Mew smiled.
"Ugh increible.. what more you want mujer!" Ludicolo groaned.
(Ding!)
Groans.
"Now Sing It~" Mew posed.
(Music: Pokémon Sword Shield - Gym Leader Battle Music (Full))
The epic electronic music started playing as many spectators were watching the players wo were in different parts of the massive! Stadium.
They all looked nervous as they faced their enemy in front of them, the crowd kept cheering excited to see the carnage that was about to go down, as the loud music kept playing.
Until it briefly stopped and it came back as PumpKingKing started to sing.
PumpKingKing: "Welcome everyone, to episode 19 of Mew's Newest All-Stars, Legendary World Tour, This challenge is a fight to the death, hurry up and place your bets, let's see who'll end up dead, and~~~"
Mew: "Now Go!" She cheered and the spectators started placing bets on the players they thought would lose their lifes.
Lucah: "Well looks like we're forced to fight.." She looked nervous.
OOM: "I bet this will be nice!" She charged at Lucah.
Seismethtoad: "I like rice!" He cheered.
Numel: "Well looks like I'll have to kick your ass." He boredly prepared a long range fire type attack.
Yamper: "Um can we find another way to pass-" He looked terrified as Numel shot flamethrower at him.
Joltik: "I thought we were buds friend, you wouldn't make me lose a life, right?" He looked nervous.
Flareon: "When my own is in danger, there will be no mercy for you alright." She fired a flamethrower attack at him.
Vespiqueen: "Fighting?! How repulsive! Fighting how dirty! I couldn't ever do such a sport as physical as fighting!" She slowly backed away.
Makuhita: "Fighting! I love it! Fighting! So move it! I been waiting to show off in a challenge like this since the beginning!"
Wigglytuff: "Fighting! I'll win this! Fighting! You're finished! You're going down newbie as I will defeat ya!" She smirked.
Krookodile: "Fighting! Is my thing! Fighting let's battle on the ring! I won't go down so easily pink bunny!" He charged at her.
Kangaskhan: "Do we really have to fight..." She backed away as she glanced up and saw how low her hearts were.
Ludicolo: "Sorry Señorita but I have to win aight!" He charged at her.
Crack-A-Chu: "Haha you're going down!" He grinned using electric type attacks.
Eva: "I'm gonna make you frown!" She charged at him.
Pincurchin: "Ugh back in my days, we used to do these tournaments around my town!"
Handy: *They did hand signs*
Wooloo: "Hey you'll go easy on me right?"
Totodile: "Gua gua gua gua gua guagua gua gua guaguagua gua guaguaguaguaguaguagua!!!!"
Mew: "Wactching this is so much fun, say who are the players that have lost so far?"
PumpKingKing: Lucah defeated OOM, Numel scorched Yamper, Joltik is down by Flareon and Wigglytuff rekt Krookodile!"
Mew: Don't forget that Ludicolo defeated Kangaskhan, Crack-A-Chu shocked Eva, Pincurchin won against Handy, and Totodile guaed Wooloo into submission!"
Alcreamie: "Woah isn't this kinda fun!" She smiled.
Foe: "So many people are watching us battle tho~" He smoked a blunt.
Magby: "Ugh can you just take your loss fast!" He attacked Eiscue and he dodged it.
Eiscue: "Nope, you gotta earn it ,man~" He shrugged as he kept dogging.
Druddigon: "You are going down this time!" He growled.
Toxtricity: "Your Life, will be mine." He glared.
Dusclops: "I wont be defeated so easily again!" He charged.
Solrock: "Psh whatever you say, edgelord." She rolled her eyes and Dusclops growled.
Mothim: "Um can I please defeat you?" He asked.
Stonjourner: "..." He smashed Mothim and made him lose one heart.
Psyduck: "You are going to go down in this fight!" She pointed at the metallic droid.
J4N-R: "You flesh biological creatures, do not comprehend my might." He glared.
Foe defeated Alcreamie
Magby eventually defeated Eiscue
Druddigon and Toxtricity had an epic fight, Toxtricity however won.
After a long fight, Solrock defeated Dusclops.
Stonjourner as show befored, smashed Mothim.
Seismethtoad looked dizzy as he lost a heart against Sylveons moonblast.
J4N-R made Psyduck turn into nothing but ashes.
(NEW BRACKETS!!!!!)
The electronic music was still playing.
Toxtricity vs Lucah
Flareon vs Sylveon
Makuhita vs Numel
Wigglytuff vs Ludicolo
Crack-A-Chu vs Solrock
Totodile vs Magby
Stonjourner vs Foe
J4N-R vs Gardevoir
(Now Playing: Sword and Shield, Gym Leader Music, Final Pokemon Theme)
The players got in battle positions and faced their enemies. The Spectators suddenly stated chanting.
Spectators: Go! Go! Go Go Go Go! Go! Go! Go Go Go Go!
Toxtricity destroyed Lucah and made her lose a heart.
Crowd: Ahhhh ahhh ah ahhh~ x2
Makuhita used his brute strength to over power Numel.
Spectators: Ahhh ahh ah ahhh~ x2
Wigglytuff defeated Ludicolo using her power.
Viewers: Ahhh ah ahhh ahh~~~ x2
Solrock easily defeated Crack-A-Chu after she managed to keep up to his speed using Rock Polish.
The stadium: Ahhh ahhh ahhhhh~ x2
Totodile shot an Aqua Jet to Magby, making him lose a heart.
Spectators: Go Go! Go Go Go Go!
Foe turned into a Machamp and punched Stonjourner, the pile of rocks, broke.
Viewers: Go! Go! Go Go Go Go!
Flareon felt awkward and didn't want to lose a heart, but also fight her mom. Sylveon told her it was okay, and Flareon cried and started to attack her mom until she lost a heart. Flareon then ran to her mother and hugged her. Sylveon just hugged her back and kept telling her she did nothing wrong, as now Sylveon only had 2 hearts.
Crowd: Go! Go! Go Go Go Go!
J4N-R and Gardevoir had an epic long fight, however Gardevoir noticed J4N-R new body was faster, stronger and had more defenses than the last. J4N-R quickly placed Gardevoir in a choke hold and suffocated him, making him lose one heart.
The Spectators: Go! Go! Go Go Go Go!
Semi-Final Rounds!:
Flareon vs Solrock
Wigglytuff vs J4N-R
Totodile vs Foe
Toxtricity vs Makuhita
Spectators: Go! Go! Go! Go! Go! Go!
Flareon: "You'll go easy on me right.." She slowly backed away.
Solrock: "...say Goodnight..." She boredly used Stone Edge and fainted Flareon.
Crowd: Go! Go! Go Go Go Go Go!
Totodile: Gua! gua! guaguaguagua!" She looked nervous.
Foe: "Sorry about this dude!" Foe used Dark Pulse.
Viewers: Go! Go! Go Go Go Go!
Wigglytuff: "Hey don't you remember when we fucked, come on give me this one chance.."
J4N-R: "Initiating Begone Thot Protocol." J4N-R pointed his blaster straight at Wigglytuffs head and shot her dead.
The Spectators: "Go! Go! Go Go Go Go!
Makuhita: "Wanna throw down brah!" He grinned.
Toxtricity just glared as he used Poison Jab multiple times killing Makuhita and making him lose a life.
(Song End)
"Congratulations you four, it seems you are the strongest of the strong, however let's see who will be fighting who towards the finals!?" Mew pointed at the grand TV on the stadium.
J4N-R vs Solrock
Foe vs Toxtricity
"Now Fight!" Mew yelled.
The crowd was going wild as the spectators kept cheering, Go! Go! Go Go Go Go!
Solrock looked at J4N-R carefully as she Rock Polished.
J4N-R however was using his advanced facial recognition to see the best way to take her down. J4N-R suddenly started dashing towards Solrock, she barely dodged it, however J4N-R was faster and threw himself against her while repeatedly punching her hard. His metal fists cracking her solid rock body, until she broke.
"SOLROCK!!!" Druddigon yelled worried.
Pumpkingking smiled and snapped his fingers as Solrock respawned. "That sucked... it's like... I stood no chance..." She grumbled.
J4N-R simply said nothing and walked to the bleachers waiting to see who he would face in the finals.
"Wow boss, you sure wrecked her! I remember when I faced her in season one. She was the reason I got eliminated!" Makuhita crossed his arms.
J4N-R said nothing, he was cold.
Makuhita and OOM felt awkward now.
"Um, I'm so proud of you for getting so far in the tournament Makuhita! You did well." OOM smiled.
"Awe shucks, thanks, are you happy for me too Janitor?" Makuhita asked smiling.
"My name is J4N-R. Janitor was my old, weak form. I am now the improved version I can be." J4N-R spoke not even looking at his "allies"
Makuhita frowned. "I don't know boss... you're kind of... cold now... and that stunt with Solrock sure hasn't gotten you a lot of fans..." Makuhita frowned.
"I'm calculating every possible outcome, my internal cloud storage allows me to download data of everyone here. I'm sure they won't vote me yet." J4N-R spoke coldy. OOM looked sad.
"Not to be rude boss... but... you're speaking with just charts and data, but not with your feelings. Just cause the percentage of them not voting you tonight isn't the highest doesn't mean it's impossible for them to do it. What if they do and you're out, you don't have any rare or common candies.." Makuhita told J4N-R.
The Dark Droid turned around and stared at Makuhita with his red glowing eyes. Makuhita under his glaring gaze, felt terrified and cold.
"Feelings are what makes biological creatures irrational and make mistakes, if you focus on your feelings instead of data and pure facts. You are more likely to make mistakes. I've made many mistakes in my previous inferior form. I do not plan to lose yet again, as your ally, I ask o you two to trust me and follow my orders. I've got a plan perfectly planned out alright." J4N-R spoke.
Makuhita and OOM looked at eachother worried.
Foe vs Toxtricity
They both got in battleing stance
(Music Playing: Sword and Shield - Battle Team Yell)
"Just go down easily freak and get this over with." Toxtricity growled.
"Um... sorry bro but I've wanted to kick your ass for a while now, you're always being a huge asshole to people." Foe smoked a cigarette anxiously.
"Heh, then die." Toxtricity used Poison Jab and Foe got hit, but it wasn't very effective.
"Huh?!" Toxtricity looked shocked as Foe wasn't poisoned.
"I'm a Dark and Poison type dude heheh." Foe grinned.
"So you won't be affected by my Poison type attacks... good thing I don't only have to use that." Toxtricity grinned as he began to shine and grow, grow, grow. Red clouds above him as he became, Gigatamax Toxtricity.
"Aweee shiet..." Foe frowned.
The stadium crowd of spectators was going wild and cheering, all the other players in the bleachers looked amazed.
"Well if you gonna use someone strong, might as well go all out dude!" Foe grabbed the hoodie around his neck and pulled it down, to show he was wearing some sort of Zoroarkite in a necklace and he began glowing.
Everyone looked shocked.
Foe became slightly bigger, his eyes instead of red turned yellow with red pupils and his entire body became white with red markings. (Yes he did look like a Hisuian Zoroark but i made the desing before that was even a thing, just saying)
Mega Zoroark roared.
Gigatamax Toxtricty used Max Stun-Shock, however Mega Zoroark used Protect and then agility as it began running toward Toxtricty.
Gigantamax Toxtricty used Max Ooze, Mega Zoroark took the hit and continued fighting, as he used Night Slash and landed a critical hit.
Gigantamax Toxtricty snarled as it used Max Stun-Shock, but Mega Zoroark used Protect as it growled.
The three turns were up, Toxtricty reverted to his normal size instead of being huge.
Toxtricty used Poison Jab on Mega Zoroark, but he used Psycho Cut! It hurted Toxtricity a lot.
Toxtricity stumbled back and then got slashed in half as Mega Zoroark used Shadow Claw and landed a critical hit.
Pumpkingking snapped his fingers and Toxtricty was revived.
However Mega Zoroark charged towards Toxtricity.
"~I'm not done with you yet~" Mega Zoroark smirked as he used Psycho Cut on Toxtricty repeatedly making him lose many lifes.
Toxtricty tried to fight back with Poison Jab but Mega Zoroark grabbed him. "Not too strong when you can't Poison your enemy are you..." Mega Zoroark grinned.
"Foe stop! He is already at 2.5HP!" Lucah told him worried.
Mega Zoroark however kept attacking him and glared, it seemed like he was having a flashback...
foe
Foe
FOE
Zoroark opened his eyes and he was in some sort of tube, many humans were taking notes and examining him, they wore white lab coats.
"First Omnipotent Experiment, FOE do you copy." A male scientist spoke.
Zoroark looked scared he didn't know what was going on.
"The Fusion of a Zoroark, a Scrafty and a Skunktank has awoken, test out it's shape-shifting abilities." Spoke a scientist.
Suddenly the tube... Foe was trapped on began being set ablaze, as flames and scars burned Foe he screamed in pain.
"First Omnipotent Experiment, you can make the pain go away, as long as you shapeshift into any of these fire types using your illusion ability." The leader scientist spoke coldy as he holded pictures of many fire types pokemon.
Foe tried to change, he really did, but he didn't know how.
After a few minutes they turned off the fire... and the tube was quickly filled with water.
"Foe, to avoid drowning turn into any of these water types." The scientist was holding images of many water type pokemon.
Foe had no idea how to swim so he panicked and struggled and sank to the bottom where he accidentally breathed in water and began gagging as he passed out.
Foe then was awoken by being in a cage, he was electrocuted and zapped.
"First Omnipotent Experiment, use your shapeshifting ability to turn into an electric or ground type so the pain goes away." a female scientist spoke.
Foe screamed as he didn't know what was going on or how to shapeshift.
Foe passe don't and when he awoke he was in a metal table strapped. Foe looked around.
"Where am i..." Foe spoke on pokespeech.
"You pissed them off, now they will try their final thing." said a voice.
"what... who is that..." Asked Foe.
"Up here dude, I'm a fucking Ditto" Said the pink blob.
"Are you a boy or a girl?" Asked Foe.
"uh... I'm non-binary gosh rude." Ditto rolled their eyes.
"...sorry I am just so confused, I don't remember my life I just remember being in a tube.." Foe spoke looking around.
"Yea that's what all of the guys say, the last one said the same thing." Ditto shrugged
"What are you talking about sir?" Asked Foe.
"Bro, you still don't get it? You are a CLONE!" Ditto spoke.
"what?!" Foe asked.
"You aren't real, you are an Experiment created by the evil scientist, Dr Val Zack." Ditto told him
Foe just looked confused.
"Dr Val Zack has created many evil inventions, he even created an artificial intelligence Android called Dark I. Assistant, or DIA for short. Dia has helped Dr Zackary many times on many evil Experiments with you being his most recent one bro." Ditto spoke chuckling.
Foe just looked horrified and had no idea what to say.
"Why did Dr Zack and Dia invent you? You see Foe the Pokemon World isn't as peaceful as it once was. There are many wars and angry manchilds screaming about what is the best region and best waifu pokemon, so inevitably wars stared." Ditto shrugged.
Foe looked confused.
"Dude this agency is called the WHIF, What does it stand for, psh what the hell do i know, I don't know everything! But what I do know is that they make illegal weapons and sell them to the highest state bitter, you are their latest weapon." Ditto spoke.
Foe didn't speak, this was too much to take in
"Ah, Project #420, The First Omnipotent Experiment, or FOE for short. You see they wanted to make a pokemon battle in the war field, a strong one that can hold its own in battle but if needed, it can shapeshift to become at an advantage during a fight, you are that great creation, Foe. The physical strength of a Scrafty, The immunity of badly poison of Skunktank and the speed and illusion abilities of Zoroark, you are the combination of many pokemon to create the strongest pokemom ever." Ditto grinned.
"I- wah.. how do you know all this!" Asked Foe.
"Because I also helped create you! I am a Ditto, they used my shapeshifting DNA and gave it in your coding, I'm the reason you can shapeshift!" Ditto smiled.
"... but... i- i- I never wanted this! I never wanted to be in whatever this sick mess is!" Foe said.
Ditto frowned and saw the door opened as a male scientist wearing a black lab coat and an edgy looking small Assistant, she looked pretty dark.
"Oh, you might wanna shapeshift into a steel type this time." Ditto spoke nonchalantly.
"But I don't know how to shapeshift!" Foe yelled.
"Heh sorry dude, looks like you're kinda fucked man." Ditto laughed.
Dr Val Zack was on a huge computer pressing buttons "Dark Assistant, turn on the power switch."
"Yes Master." Said Dark Assistant as she flipped a switch. Then many sawblades were slowly decending down into Foe, who was still strapped to the metal table.
"HELP! ANYONE! PLEASE!" Foe screamed.
"Bro chill, you won't die; but you'll wish you could." Ditto giggled evilly as it was revealed they worked for Dr Zack.
The sawblades began to lower closer and closer into Foe.
"First Omnipotent Experiment, Shapeshift into either a Rock or Steel type, and the pain will not come." Dr Val spoke as his glasses shined.
Dark Assistant was smirking.
"I DON'T KNOW HOW! PLEASE STOP THIS! PLEASE! PLEASE!" Foe screamed and cried as the sawblades began to cut his stomach, blood splattered on the walls as slowly Foe was cut in half.
Dr Val wrote some notes on a clipboard, got Ditto and Dark Assistant and left the room. Foe was slowly bleeding out and his vision became hazy, however he relaxed his muscles and melted, his entire body turned pink and gooey, as he became slimey, he then slowly formed into... a Ditto, he looked at himself, and went through a vent. Foe wanted to escape.
He saw a room full of scientists and concentrated, he then slowly shapeshifted into a gastly, he turned invisible and passed through the room, he saw a meltal wall and couldn't pass through it. Even as a ghost.
He shapeshifted into a Charmeleon and used heat to burn the metal off, after he used Flamethrower, Foe turned into a Rattata and ran away outside of the lab, but then he realized he was in an island. Foe looked nervous and them shapeshifted into a Mudkip.
"That's enough Foe. You aren't getting farther than this." Dr Val Zack grinned. Dark Assistant stood next to him on the left and Ditto was smirking on the right.
Foe looked nervous and because of his nervousness and anxiety he was forced to shapeshift back into his original Foe form.
"We have the entire island surrounded by water type pokemon we hired so Experiments like you can't escape." Dark Assistant spoke in a fancy British voice.
Then Foe looked back and out of the water a Sharpedo, Male Jellicent, and Many Basculins grinned.
Foe looked back shocked as a Gengar, an Alakazam and a Machamp walked closer to him.
The Machamp used a Mach Punch on Foe knocking his ass out.
... now this is where his season 1 audition starts
In a dark laboratory in the human years, deep underground. There was an experiment, an experiment humans were doing with pokemon.
You see they were trying to make a pokemon with the physical strength of a Scrafty, the illusion abilities of Zoroark and the shapeshifter abilities of a Ditto.
The creation of a new pokemon, one which could change its appearance to any other pokemon like Ditto can, but is actually strong.
Would be incredibly cool.
So that's what these Scientist were doing, and they failed again and again and again...
All their subjects either died, or couldn't transform so they were tortured and killed.
However many experiments were being made at the same time and one was looking promising. They nicknamed him a code name.
. F . O . E .
FOE
He was being forced to shapeshift and it worked, he was whipped and electrocuted if he didn't do it. So he learned that he had no free choice.
After being hurt for many years the Scientist dipped The Fusion inside a tube full of green liquid. (The Fusion was Foe's original nickname in season one before being changed to The Radical Stoner)
Now, We see some sort of creature floating around green liquid in a tube.
"Subject 420, Attempt 360. Specimen F . O . E fusion of Zoroark Ditto and Scrafty. Last few attempts have died cause of health reasons let's see if this one will live." Said... A Human!? In a white lab coat.
Other Human scientists nodded and pressed buttons. The glass doors opened and, F . O . E came out.
"First Omnipotent Experiment number 420. Can you hear us?" The Scientist spoke while Foe fell to the ground. He didn't stand up. The Radiactive Toxins of the water tube were Apperantly too much for the medium size fusion, it was supposed to enhance his shapeshifting abilities, but the scientists saw him fall down and not get up and called him a failure.
Silence.
"It appears Attempt number 420 was also failure, bring in the next-" suddenly the scientist throat was pierced by a Bisharp.
The scientist fell down and died.
The others looked shocked.
The scientist threw out Magneton and Beheeyem.
The Bisharp glanced and suddenly shape shifts Into a Gengar. He sended a powerful Shadow Ball at Beheeyem fainting him.
Foe turned into a Darmanitan and used Flame Charge at Magneton fainting him. Foe then turned into a Greninja and killed the other scientists.
"Report! Report! Code Red! Subject 420 has Rebeled and is causing genocide here! Send back up! I repeat send! NO AH!" The Scientist gave a blood curling scream as she was speaking to the PA microphone; Before being killed by Foe.
We see Foe in his fusion form start breaking the technology items around the science room. His eyes were red and he was snarling like a wild feral animal.
"Who are you!" Screamed a scientist scared. Foe picked him up by his throat. "We, Are, Foe." Foe glared and spoke on a dark tone. He then snapped the Scientist throat, killing him.
The screen zoomed away as Foe kept shapeshifting and destroying the dark lab.
Dr Val, Ditto and Dark Assistant escaped using a secret Time Machine Zackary created behind everyones back.
Foe tried to kill them three but they escaped. In Rage Foe killed more scientists and destroyed the entire island.
After his rage ended Foe looked around and realized what he did, he was horrified, he was terrified, Foe knew more people would come here, armed this time. Foe was stressed, anxious and scared, he didn't know how to fix everything.
"Hey, smoke this, trust me bro it's gonna fix everything~" Pumpkingking smirked.
Foe grabbed the joint and smoked the blunt. Foe became high. "Woah bro, that hits the spot..." Foe smirked.
"Sure does." Pumpkingking grinned.
Foe spend hours talking with Pumpkingking blazed.
Truth is experiments the other scientists made Foe go through were painful, they once cutted open his stomach just to see his insides which is why Foe has a huge scar on his stomach, and also cutted his wrists just to see how much pain he could endure; And that's just a few experiments, now you know why that question Pkk did in season one hurted Foe so much, it was Foe how did you get those cuts.
Foe was always beaten and shocked by the scientist. So he felt a lot of anger and rage towards all l humans. Foe smoked the cigarettes and coughed while grinning. He felt so relaxed and all his stress/anxiety went away.
"Here, have some packs and a bunch of lighter, you seem like you'll need them." Pumpkingking smiled and shoved them inside Foes big black Mohawk hair.
"Radical dude." Foe smirked as he smoked blazed. Them he spoke with Pkk about life and chill stuff for a few minutes before many ships and air helicopters were closing into the island.
"Bummer dude, these guys just won't leave me in peace..." Foe frowned smoking more.
"Heh I know how to fix this." Pumpkingking snapped his fingers, and teleported Foe into season 1, Mew's New Island.
Flashback end (wow that was long af)
Mega Zoroark just looked neutral and frowning as he slowly stopped using Psycho Cuts on Toxtricity, who was super dead under him. Apparently Foe had been slashing and attacking him the entire time he was remembering his backstory.
"Ugh! Being sober is making all my memories come back!" Mega Foe growled.
"Foe, calm down, don't panic." Lucah tried to calm him down.
Foe just stared at her in shock, and instead saw the scientists from the lab saying, Foe, Calm down, don't panic, as they were holding big needles to inject him with.
"No! Leave me alone!" Foe turned into a Charizard and used Flamethrower on her making her lose a life.
"Ah!" Lucah groaned in pain as she lost a heart
"Lucah! Foe is obviously in a post traumatic stress trance! We have to knock some sense into him!" Druddigon ran towards Foe.
Mega Zoroark used Night Slash on Druddigon and Druddigon used Dragon Claw.
Mega Foe growled and used Psycho Cut.
Solrock used Stone Edge hurting Mega Foe.
Mega Zoroark snarled and ran towards them but then Lucario used Bullet Punch, fainting Foe and making him lose a heart. Mega Zoroark returned to his regular Zoroark form, aka Foe.
"Yep, his ass is knocked out cold, but he'll live." Pumpkingking shrugged.
Then suddenly everything started to get dark, darker yet darkest as the day seemed like night.
"Ah fuck, The Darkest Day is supposed to happen today?! I really gotta get this thing fixed." PumpKingKing tapped his handwatch nonchalantly.
"What the hell?! what do you mean Darkest day!" Gardevoir yelled.
"Wellllllll, apperantly an Ultra Beast slash weird looking ass FAKEMON from another DIMENSION, HA GET IT" PumpKingKing yelled dimension at the fourth wall while grabbing and shaking it.
"-is coming here, that there is Eternatus! and the next legendary you will have to catch! Time and Dimensions breaking must've made the darkest day happen 1,000 years faster." PumpKingKing shrugged.
"Wait... we are going to catch that!!!" Alcreamie looked nervous as she pointed at Eternatus, it looked like an unexplainable purple dragon, as it roared.
"Yep! Right after these commercial breaks!" Mew smiled at the fourth wall.
