Fakemon Dimensions! Part 4!!!
(The Galor Region - Wyndon Stadium)
Eternatus growled as it flew above the stadium.
"What are you waiting for.. catch that thing!" Mew yelled.
(Music Playing - Pokemon Sword and Shield - Eternatus Battle)
"So uh anyone has a plan?" Mothim asked nervously.
Eternatus roared, scaring many players.
"Holy Miltank, that thing must be bigger than a Wailord!" Wigglytuff frowned.
"Solrock, what do we do?" Druddigon asked her.
"Hrg.. ok so.. we cant afford to get hit by Any of its attacks, it would cost a life and we are already low enough, just um woah!" Solrock quickly dodged Eternatus Dynamax Cannon move.
Crack-A-Chu growled and used Thunderwave on it.
Dusclops shot a Shadow Ball
Ludicolo shot an Ice Beam.
Druddigon used Flamethrower
Solrock used Psychics
Sylveon and Alcreamie used Moonblast
Eternatus got hit by them all and snarled, it hitted them but didnt do too much damage, just lowered their stats a bit...
Krookodile used Dig on it.
Druddigon got close and personal with a Dragon Claw
Mothim, Magby and Yamper were hidding with Wooloo.
Stonjourner just stood their unmoving.
Eternatus used Dynamax cannon on Stonjourner, breaking him and making him lose one life.
Eternatus used Dynamax cannon and made Joltik lose a life.
Gardevoir used Rainbow Ball and it hurted Eternatus greatly.
"Great work Gardevoir!" Magby cheered.
"Now get 'em!" Solrock glared.
All the contestants started attacking Eternatus, making his HP go down rather quickly, then Eternatus fell down and fainted.
"Nice we did it!" Cheered Flareon.
"Now lets go catch it, what the..." Numel looked surprised.
Eternatus who was on the ground began glowing red and growing as red clouds appeared above him. He was getting bigger and bigger his original dragon body was changing into something unexplainable..
"t-t-that is quite ginormous..." Vespiqueen was shivering.
The Dragon/Poison type Eternatus kept glowing red and growing, it became a gigantic claw like creature, as it became Eternemax Eternatus.
"...We're so fucked..." Solrock grumbled.
(Music: Eternamax Eternatus Battle)
The colossal dragon flew over them, it was too big and it was above all of them. Eternamax Eternatus prepared an attack.
"Run!" Druddigon warned as they all ran away.
It had shot Eternabeam, making Stonjourner, OOM, Vespiqueen and Handy lose one life.
"Boss one of our comrades is down!" Makuhita yelled as he was running away from Eternatus.
J4N-R said nothing but was using his scanning to determine what the dragons weakpoints were, eventually it spoke. "It has no weak points. It's entire body is made out of a metallic like material and the red energy coming out of the holes is just plasma ready to be shot at." J4N-R dodged an Dynamax Cannon.
"Bullshit! We have to fight it off somehow! Totodile you're quick go take the small ones and the ones with low hearts away from this battle!" Druddigon ordered.
Totodile nodded and grabbed handy, Wooloo, Mothim, Kangaskhan and Lucario.
"I can't leave you Gardevoir.." Magby yelled.
"I'll be fine ok, just watch." Gardevoir glared as he began glowing, the light was big and so was his dress. He was now Mega Gardevoir.
"..woah.." Magby looked shocked.
Mega Gardevoir smirked as he used Rainbow Ball. It was super effective against Eternatus.
Eternatus had its special defense drastically lowered and Mega Gardevoirs accuracy rose.
J4N-R ran towards Eternatus and climbed on top of it, Eternatus was shaking wildly.
"Hurry shoot it's core!" J4N-R pointed at the red core at the center of Eternatus claw like face.
Mega Gardevoir used Rainbow Ball
Krookodile used Dig
Druddigon used Dragon Claw
Psyduck and Solrock used Psychic
Dusclops shot Shadow Ball
Alcreamie and Sylveon used Moonblast
Totodile came back and used Ice Beam with Ludicolo
Crack-A-Chu used Thunderbolt
and Handy flipped off Eternatus
Eternamax Eternatus was being hit left and right with many powerful attacks, in one final gambit, Eternamax Eternatus shot an Eternabeam at Magby.
Magby looked horrified.
Suddenly Mega Gardevoir stood in front of him and used protect, casting a huge shield around those two.
"MOVE NOW!!!!" Mega Gardevoir screamed.
Magby quickly moved out of the way when he noticed the protect shield was shattering, and then, the shield broke, Mega Gardevoir got hit full Blast with the Eternabeam.
"NO!" Screamed Magby.
The other players gasped.
J4N-R who was still on top of Eternatus made his right arm turn into a huge super sized Pulse Cannon. "Don't try to rebel your capture, you scum." J4N-R then shot the powerful cannon ball size plasma shot right into Eternatus core making the gigantic claw like monstrosity fall down and crash. J4N-R however jumped off before hand, and walked away as a huge explosion was behind him.
"That's gonna look pretty cool when this fanfic becomes an animated show." PumpKingKing smiled.
"What?" Mew asked him.
"Gardevoir! Gardevoir!" Magby yelled.
Mega Gardevoir had turned back into Gardevoir.
"Ow.. heh hey.." He smiled.
"Oh thank arceus you're alive!" Magby was crying a bit.
"my everything hurts." Gardevoir spoke. He had one life left.
"I'm so glad you're alive Gardevoir, I don't know what I'd do without you..." Magby hugged him. Gardevoir hugged back and spoke. "Thanks kiddo.."
J4N-R prepared to throw his ball to capture Eternatus. "Finders keepers!" PumpKingKing captured him first.
"We did it everyone, so what do we do now?" Asked Dusclops.
"Alrighty, so that ends today's challenge, or does it? You see J4N-R and Foe are still on the finals in the battle tournament, so they gotta fight!" Mew used her magic to teleport them both to the Stadium.
(Music Playing - Sword and Shield Chairman Rose battle)
"But... Foe is tired!" Lucah spoke.
Foe grumbled as he just woke up.
J4N-R cracked his metallic knuckles to intimidate the stoner.
"No weapons Janitor, just your cold metal fists." Mew smiled.
"Just the way I like it." J4N-R began walking towards Foe
"Holy shiet dude, come on we can talk about this.." Foe was nervously walking back.
J4N-R being a cold calculating machine, felt no emotions or pity therefore he rushed and used a metallic sucker punch on Foes face.
"Ah fuck! Alright you had this coming bro!" Foe shapeshifted into a huge Gorilla covered in flames, a Darmanitan.
J4N-R felt no fear as he began running towards Foe, using punch after punch, easily blocking Foes punches and countering with a metallic kick.
"Ugh!!" Foe growled from the pain. J4N-R used an Uppercut with his iron fist, making Foe shapeshift back into its original form and spit out some blood.
Foe lost a heart, now he only had two lives...
Mew was about to declare the battle was over but PumpKingKing raised his hand as if saying, wait, PumpKingKing had a malicious smirk.
Foe looked pissed off seeing J4N-R walk away. Foe shapeshifted into an Inferape, the fire fighting monkey quickly rushed at J4N-R and started punching his steel body with fire covered fists.
However J4N-R being a genius knew the weaknesses of his armor, which why he made it water and fire proof.
J4N-R glared with his red eyes. "If killing you is what you want, then your wish will be granted." J4N-R used a punch but Foe grabbed it with his hand, using that inertial he quickly spun and threw J4N-R against the wall. The wall collapsed and crushed J4N-R, he had lost 0.5 Hearts.
"I am undefeatable you fusion! I was born perfectly, you had to be made with DNA coding of others." J4N-R glared.
Foe snarled and shapeshifted into an Alakazam, using his psychic powers he grabbed J4N-R and slammed him multiple times against the ground, J4N-R however using his IQ, when he was slammed on the ground for the 8th time, he grabbed a bit of dirt and threw it on Alalazams eye making him blind.
J4N-R then quickly performed a metallic roundhouse kick on Foes head. Foe yelled and shapeshifted into an Electivire, It used it's power to summon a Thunder from the sky who landed on J4N-R, The droid was beginning to be overcharged and exploded. Losing one life.
J4N-R stood up and using the electricity he gathered shot a plasma cannon from his stomach. Foe shapeshifted into a Floatzle and quickly dodged it, Then shot J4N-R multiple times with highly compressed water shots, J4N-R after being hit 4 times began dodging them more effectively, but then Foe shapeshifted into an abomasnow and used Ice Beam on the field, making J4N-R trip and fall.
J4N-R growled as his feet became spiky, kinda like football shoes. The metal broke the slippery ice when he stepped on it and prevented J4N-R from falling.
Foe made it so the battle field was covered in a deep fog, J4N-R simply used his movement sensors, and detected nothing, he was then hit by a beam of pure ice, J4N-R lose half a heart, and now only had 2 hearts left, just like Foe.
The players were all shocked.
"Stop the fight now!" Lucah yelled.
"Ratings!" Mew and PumpKingKing laughed.
J4N-R kept being hit by ice beams from the unknown, so he turned on his thermal heat vision, and spotted Foe. Having had enough J4N-R loaded his G-8 Z5 Empire Blaster and shot Foe bullseye dead in the skull.
Foe died, but had one final life.
Foe growled and shapeshifted into a Dragonite, he quickly tackled J4N-R down and used Flamethrower on his face, J4N-Rs face was turning red as he never expected this dragons fire temperature to be this blazing hot, his heatproof armor was breaking down.
J4N-R had his left arm turn into a Purple Lightsaber and stabbed the Dragon in the arm cutting it off, Foe screamed and flew away.
J4N-R noticed the fog was messing with his already Damaged sensors, as his faceplate was a bit melted already. Using his Lightsaber he began to spin it, making the wind blow and fog go away, then suddenly he didn't see the dragon around him, only to realize to late, He was above him. Foe used a Giga Impact at J4N-R crushing his body and making him lose one life, however when the smoke cleared we see both Foe in his regular form and a broken beaten up J4N-R who was twitching and sparking.
Both Foe and J4N-R had one life, it was the final good vs evil battle.
"Foe!" Lucah screamed.
"Love!" OOM yelled worried.
"Boss!" Makuhita looked shocked.
Foe quickly stood up, and using his Scrafty strength, ripped off J4N-R Lightsaber arm.
J4N-R glared and tried to shoot him with his other arm but Foe used J4N-R own arm to slice his blaster arm.
J4N-R had 0.5 HP left
J4N-R fell to his knees and like that old man Count Dooku.
Foe glared holding the Lightsaber, he looked at J4N-R who looked weakened and defeated, just like how he felt when he was being tortured in the lab being experimented on.
Foe threw away the lightsaber. "I won't kill you Janitor." Foe spared him.
J4N-R looked shocked and vowed to Foe.
Foe smiled and looked back at Lucah happily.
However J4N-R planned an evil ruse, his B1 droid backpack quickly turned into a big Plasma Cannon, by the time Foe turned around, J4N-R had already taken the shot, Foe was blasted right in the heart, his stomach now had a huge hole. Foe had blood coming out of his mouth as he kneeled.
"You were a fool for trying to kill me. You never stood a chance fusion, I built myself to be the strongest in the entire galaxy." J4N-R spoke coldy.
"...you.. you..." Foe gasped for air.
"Yes, biological creature say your final words." J4N-R stared at him as his nanobots were quickly building new arms for him.
"...you will die alone bro..." Foe told to J4N-R. He looked shocked.
"...power isn't everything... they made me to be the most powerful weapon, and look how useful that was, just for a pointless fight... that won't matter in centuries..." Foe groaned.
"It will matter. Once I rule the entire galaxy." J4N-R was then interrupted. "...Again? Didn't you do that already dude, yea PumpKingKing told me, you conquered the entire galaxy, that is why I told all of my friends and that is why they don't trust you, they see you as a huge threat..." Foe spoke.
J4N-R was calculating his chances of winning this game, and the percentage was quickly diminishing.
"...why do the goal you already finished, what does it give you... didn't you felt useless after your goal of eliminating all life form and taking over the galaxy was done?..." Foe spoke.
"ENOUGH!" J4N-R picked up Foe and split him in half, he threw away his leg part and was holding his arm to look at him straight in the face.
"I will wish to have godlike powers, so not even gods like the PumpKingKing can stop me from making my perfect galaxy, where I can create it and destroy it however I wish for all of eternity." J4N-R glared.
"...by the end of it... you will have nothing... no friends... no power... no... emotions..." Foe gave his final breathe as he passed away.
The Stadium TV said Winner J4N-R, Foe has been eliminated.
J4N-R was still shocked by those final words Foe had, he just quickly threw away his body and walked away.
Lucah ran towards Foe and she cried.
The Heros looked nervous and even the villains looked sad.
"I want J4N-R gone, forever." Lucah glared.
The others nodded.
PumpKingKing and Mew Announced everyone to go back into the wild area, the plane was parked there ready to pick everyone up. However then when everyone was inside the cargo hold, a portal opened and we saw Togepi and Flygon.
"Heh, they have a few seconds before they are both automatically eliminated." PumpKingKing smirked crossing his arms.
"RUN! RUN! RUN!" They were all yelling.
"Togepi and Flygon have 15 seconds to reach the finish flag or they're automatically eliminated!" PumpKingKing hosted holding a microphone.
"GO! RUN! MOVE! YOU'LL DIE!!" Many contestants started screaming.
Flygon and Togepi looked scared and began running, Flygon was slow but then Togepi began doing cartwheels and started going significantly faster like a car wheel, she crossed the finish line, which had been super far away in the wild area.
Flygon was running as fast as she could since she couldn't fly but... she ran out of time.
"Times Up!" Mew smiled.
"Wait what no please wait!!!" Togepi screamed.
The players were far away, so they couldn't listen what Flygon was whispering to Togepi while crying. Togepi was also crying a lot.
Then Flygon was shot by the finger gun of PumpKingKing.
Flygon was being electrocuted, and burned alive, Flygon screamed in pain and after a few seconds, she was dead.
Togepi fell down to the floor and started crying seeing her friend die.
The players felt awkward.
"Welp let's go to the plane to vote off people!" Mew smiled as she teleported everyone away.
(However, what happened to Togepi and Flygon before they were teleported back into the game?!)
(Flygon and Togepi: Traveling in a Interdimensional Time Warp after they disappeared for the first time)
As Togepi and Flygon screamed as they were falling down through the portal and everything was glitching around them, they were then thrown into grass, bad quality one at that.
"Ugh what the hell.." Flygon rubbed her head.
"I'm never taking the subway ever again." Togepi looked tired.
As Togepi and Flygon stood up and looked around they realized something.
"GASP! I left my oven on, damn it!" Togepi cursed.
"wha.. Togepi! We just been teleported to a brand new dimension! Look how cheap the animation is!" Flygon looked at herself.
"Gasp! Omg this thing is so cute, can we keep it!" Togepi smiled.
"Popotatoz!" Said a small potato with a derpy face.
"Hey dont touch that, you dont know what it does or who that is!" Flygon yelled.
"Hello! I see you met my brother Popotatoz! My name is Nutty, the evolution of Popotatoz and we are Fakemon!" Nutty spoke, he looked like a tall nut with a silly face.
"Awe you both look so cute!" Togepi smiled while Flygon frowned.
"Oh you must meet our friends! This is Banakawaii!" Nutty showed a cute banana with big anime eyes.
Togepi hugged it.
"Her parents, Planoburst and Planofrost!" Nutty spoke.
"Sup." Planoburst smiled as he was set ablaze.
"It's so nice to finally see some fresh faces!" Planofrost giggled as she was ice.
"Here is Ciryu, Ghotitaz, Flammer, Flammburst, Fizzard, Ghostarz, Clawchu and Plantyactyl!" Nutty introduced them all.
Ciryu was a ball with a star on its face, the star had a sharp eye.
Ghotitaz and Ghostarz looked similar just one was a happy waterdrop with droplet arms and legs, and the other was a sad teardrop with tear arms and legs.
Fizzard, lookeed like a small red lizard that had black markings.
Flammer and Flammburst were uh fire thingies.
Clawchu, looked like an angler fish but cute, and Plantyactyl looked like a bipedal plant raptot which leaf wings and other stuff ig.
"They all look awesome! Hi everyone!" Togepi waved.
"Uh yea.. it's quite nice to see you all too but we really gotta find a way back ho-" Flygon was talking but then interrupted by Nutty.
"We also have Rozie, Fiforty male and female, Cob, Cobbik, Cirmie and there should be others nearby." Nutty spoke.
Togepi looked amazed at all the fakemons, Rozie was a purple plant with a white flower on her head, Fifortys were both some sort of poisonous air clouds, the male one was red with purple spikes and the female one was purple with red spikes.
Cirmie looked like Ciryu but bigger, with a crown and with legs and arms. Cob and Cobbik looked like Coal with red feet, but Cobbik was bigger and looked meaner.
"Ok we met you all but we dont know where we are and we gotta go hom-" Flygon was speaking.
"You are in the plains! A long time ago we used to live in harmony with these things called humans." Nutty spoke.
"Humans?!" Togepi and Flygon asked.
"Yes humans, bipedal, kinda weak, not very smart, based." Nutty spoke.
"I'm aware of what a human is, i went to college." Flygon rolled her eyes and fixed her red glasses.
"Well one day some... thing... appeared and started snapping it's fingers! There were natural disasters happening all around us at the same time, many fakemon species went extinct and all humans were wiped out... we recovered after hundreds of years and now live in peace." Nutty spoke.
"Um what did his head look like?" Asked Togepi.
"Odd question... but he was like a orangy head.." Flammer spoke.
"The PumpKingKing!" Flygon and Togepi said surprised.
"Do you know him." Nutty frowned.
"Um you could say- ah what the.." Flygon looked around and she was tied up, same thing with Togepi.
"Sorry honey, not into bondage." Togepi told them.
"You will come with us to be interrogated by our Queens." Ghotitaz said happily.
"Well they can't be that ba- Gasp!" Togepi looked shocked.
Bergmite and Hippo were standing grinning.
"THE ICECUBE AND FAT WOMAN!" Togepi screamed.
"I'm not fat! I just have excess muscle!" Hippo screamed.
"Who are they?" Asked Flygon.
"Oh they're just some randoms from season 2, they dont really matter." Togepi frowned.
"What! We were celebrity's! We were famous, we got pretty far in season 2!" Bergmite growled.
"So um what do you want with us." Flygon asked.
"Well well well it seems you two went through it huh, you managed to find this dimension too!" Bergmite glared.
"Look we-" Flygon was interrupted.
"Majesty, you shall call us, Your Majesty." Hippo grinned. A Fakemon was feeding Bergmite Rare Candys as if she was a royal queen.
"uh... your Majesty, we didnt mean to get to this dimension, actually Togepi and i want to return back, right Togepi?" Flygon asked.
Togepi was looking at a Butterfly distracted. "Huh wah?" Togepi asked giving a silly smile.
"Togepi... i remember you from season 2, we were on opposite teams." Bergmite glared.
"I sureeeee was!" Togepi gave a big toothy smile.
Bergmite and Hippo frowned, looked at eachother and smiled.
"Well there is nothing here other than grass, there is a forcefield that prevents anyone from escaping this are, anyone who touches it dies and becomes all glitchy." Bergmite pointed at a glitchy fakemon who was twitching and screaming, he was inside a cage.
"Don't ever touch it, you dont wanna see what happened to its friend." Hippo pointed at anither glitchy screaming fakemon who was inside a cage.
Togepi and Flygon frowned.
"So we cant leave.." Flygon frowned.
"Don't think of it as bad, think of it as you now live here forever to serve all of our needs!" Bergmite grinned.
"They been here for 8 days already and as soon as they came established themselves as queens and started eating our food, hehe so silly!" Nutty smiled. Another fakemon was feeding Rare Candies to Hippo as if she was a royal Queen.
"Now begone!" Hippo clapped her hippopotamus feet and Platyactyl placed Tied up Togepi and Flygon into a catapult and threw them again.
"Ouch.." Flygon groaned.
"Psh I've heard of painful air travel prices but this is ridiculous!" Togepi smiled.
Laugh Track
"Hey, um just cause our new queens threw you away doesnt mean we cant be friends!" Nutty smiled from afar.
Flygon and Togepi noticed all the fakemon wanted to play with them.
"Uh sorry Togepi and I have to find a way home.." Flygon frowned.
"Awe what! Come on this is our chance to hang out with super cool alternative dimension peeps! They're all so nice too!" Togepi smiled.
"... Togepi, I want to go home. I dont like or trust this place... I just feel like I really need to get away from here please help me find materials to build an interdimensional transporter, using calculus, chemistry and geometry I think I've found a possible theory on how to find a way home." The Nerdy Dragon told Togepi.
"Well you go home yourself! I like it here, the people are nice and there is no dramatic life and death stakes challenges happening all the time!" Togepi looked genuinely upset as she began walking away.
"If Munchlax was still in the game would you stay here." Flygon said coldy. Togepi stopped.
"Of course, you would care about them and be worried so you'd go back, but since no one over there cares about you, you rather leave me abandoned here while you hang out with the first few people that acknowledge you, no wonder Chandelure killed herself, with how much you ignored her needs." Flygon spoke.
"DON'T YOU DARE TALK ABOUT CHANDELURE LIKE THAT!" Togepi screamed crying.
silence.
"Chandelure was my best friend... Munchlax is the closest I've had to a friend like Chandelure, who always talked to eachother, did things together and be happy... I haven't felt happy in such a long time in that old dimension and this is when I finally have a chance to stop pretending to always being happy, you can return to your fucking dimension if you want! I just want to be happy again! Don't remind me of Munchlax or Chandelure again! They're both better off without me, and so are you!" Togepi glared, wiped her tears and frowned as she walked away.
Flygon looked guilty, she extended her arm to apologize but stopped and looked away as she didnt know what to say.
(Ding.)
Togepi: "Ooo all the people that I now see! Are pokemon that are just like me!" She smiles as she sees all the fakemon being happy and grinning as they are playing around her.
Togepi: "I'm finally having fun here with no competition tension, as I enjoy being in a brand new dimension!" Togepi is playing a board game and gets a card, it says Surprise Quadruple elimination, Go back 20 spaces with the grinning faces of Bergmite and Hippo, the grass under her also started to, change...
Togepi throws the board game away and smiles as she dances with both Fifortys and then cannonballs into a lake, we see Clawchu smile as she waves with blue fishes around, and a... skull was floating in the bottom of the lake.
Togepi: "Ooooh I finally feel so free, experiencing peace and relaxation~" Togepi was having fun juggling knifes and one accidentally slipped and almost cutted and destroyed the Dimensional Teleporter Teleporter Flygon had created, Flygon growled and glared at Togepi and she said sorry as she gave a awkward smile.
Togepi: "And all I had to do was mention that I live in a brand new dimension~~" From a bit far away Hippo and Bergmite glanced at eachother Frowning and then glared at Togepi and Flygon.
Then a cast roll scene played as we see all the characters in this brand new Dimension appear.
(Song end)
"Ah that was so fun!" Togepi smiled.
"So what games should we play next?" Asked Cob.
"Let's play tag!" Ghotitaz suggested.
They all cheered and started playing.
From far away Flygon saw this and sighed.
"I guess it would be selfish to take away Togepis happiness, it's best if I leave her here after I finish my Dimensional teleporter." Flygon fixed her nerdy glasses and then kept using the screwdriver to screw the screws in the Dimensional teleporter.
"So um Flyguy." Hippo spoke.
"It's Flygon." She frowned.
"Ya, whatever, so as Queen I declare you give us that Dimensional Teleporter." Bergmite spoke.
"What, hell no why would you, AHHH!" Flygon was taken down and frozen by the Blizzard attack.
"Hehe you cant move but you can hear all we say!" Hippo grinned.
"Listen here Flygone, we need this to well travel around other dimensions, as soon as we eat all the food here, those fakefreaks will get upset, so this is our ticket out of here." Bergmite smirked holding the Prototype Dimensional Teleporter.
"-It's not finished-" Flygon spoke with teeth clenched inside the ice.
"Ah we dont need it to be finished, just enough juice to send us away from here." Bergmite grinned as she screwed the final screw in the prototype.
"You see here Flypi, we lied, This dimension is actually collapsing, the border that makes everything it touches die and glitchy, its coming closer and closer everyday, and we been trying to escape this place for a while now, thanks to you, we will escape!" Hippo smiled.
"-Everyone else here will die-" Flygon glared from inside the ice.
"Psh like we care about what happens to them, now we escape! Ah!" Bergmite had the prototype snatched away from her as Togepi returned with it like a Boomerang.
"Your Prototype is now protomine!" Togepi did a :3 face.
"-Togepi!-" Flygon smiled from inside the ice.
"Your majesty, did you really mean all that.." frowned Skuerll.
"Psh of course, now give me that teleporter you fried eggbrain!" Hippo growled.
"Over my hardboiled body!" Togepi pointed at them.
Flammer spitted an ember of flames towards Flygon which melted her from the ice block.
Cirmie used Heal Pulse on Flygon.
Hippo and Bergmite screamed shocked.
"You arent our Queen anymore, we will fight you two!" Plantyactyl glared.
"If you do, you will both die!" Bergmite grinned as she and Hippo started shining.
"We will die either way because of this glitchy mess, so at least we will die kicking the ass of the people who bossed us around for days!" Fiforty male growled.
"Yea you two suck!" Elecbant frowned.
Hippo evolved into Hippowdon and Bergmite evolved into Avalugg
"If we all fight together, we can take them down!" Nutty smiled.
"Not unless we do this!" Hippo was holding a Mega stone and Avalugg had a Red Star Shaped thing.
Hippowdon began glowing and growing bigger as more sand started to appear and her teeth became way sharper, as the entire battle field was now with sand. She was Mega Hippowdon (Yes similar to the one from my The Sinnoh Remakes fanfic, shameless plugin wink!)
Avalugg however was growing and growing, red clouds above her as she just Dynamaxed.
"This will be hard, so I will need to use this!" Flygon was holding a mega stone and began glowing. Flygon became bigger, had more spikes and looked faster as she was now Mega Flygon.
"Let's fight!" Togepi smiled.
(Battle Theme playing: Sword and Shield Vs Oleana Battle Music)
It was Mega Flygon, Togepi, Cirmie, Ciryu, Rozie, Fiforty Male and Female, Flammer, Flammburst, Ghotitaz, Ghostarz, Plantyactyl, Elecbant, Clawchu, Skuerll, Popotatoz, Fizzard and Nutty
Vs Dynamax Avalugg and Mega Hippowdown
The Fast pokemon like Ciryu, Plantyactyl, Mega Flygon and Fifortys attacked first damaging them both.
Mega Hippowdon used earthquake powered by Sand Force, Nutty, Popotatoz, Skuerll, Clawchu, Flammer, Flammburst, Elecbant Ciryu and Rozie went down.
Fiforty male and female levitated, Togepi was riding on Mega Flygons Back.
Cirmie used Thunderwave on Dynamax Avalugg, She however used Max Hailstorm on Mega Flygon almost fainting her.
Plantyactyl used Leaf Blade on Mega Hippowdon, critical hit!
Fiforty Male and Female used Flamethrower and Sludge Bomb respectively at Dynamax Avalugg.
Dynamax Avalugg snarled as she used Max Darkness fainting both Fifortys.
Togepi used Charm lowering the attack of both Mega Hippowdon and Dynamax Avalugg.
Ghotitaz and Ghostarz used Hex on Avalugg, greatly hurting her.
Mega Flygon used Smart Strike hitting Avalugg. She was about to faint so she used Max Hailstorm, Togepi used Metronome and got Protect! Flygon was protected from the ice type attack.
Quickly Cirmie used Extreme Speed to take down The Dynamax Avalugg as she returned to her normal size fainted.
Mega Hippowdon used Earthquake again and fainted Cirmie, Plantyactyl, Ghotitaz, Fizzard and Ghostar
Flygon used Dragon Claw hurting Mega Hippowdon.
Togepi used Metronome and got Ice Beam as she fainted Mega Hippowdown and she returned to her regular Hippodon form.
"We, we did it.." Togepi panted sweating.
The glitchy world was staring to get closer and closer to them as it was destroying the dimension, many Fakemon got sucked in and both Hippo and Avalugg got sucked in as well, they both finally died forever.
"I guess this is it huh." Flygon frowned as she looked around, the dimension was glitching and breaking down.
"There has to be another way, we can escape this!" Togepi looked nervous.
"Sorry girl, the dimension teleporter was broken in the fight, I may be smart but I don't have the time to make a brand new device..." Flygon looked sad as the entire world was glitching around her.
"Can't you fly us away?!" Togepi frowned.
"Ugh.. Avalugg messed up my wings real bad with that Max Hailstorm attack... I cant fly anymore..." Flygon was standing.
The glitch was getting super close.
"This is it huh..., Flygon... I'm sorry for all of this.. I'm sorry about getting angry and I'm sorry about what I said of Munchlax and Chandelure... I really miss Chandelure, and I do miss Munchlax, i felt so guilty for what happened to Chandelure for a very long time and I just been trying to hide my pain in a fake happiness facade... the game just has gotten so much more intense, I just wanted to relax... but I didnt think I about your feelings... I'm so sorry for being selfish..." Togepi looked away sad.
Flygon gave a small smile as she sad, "I forgive you Togepi, you were an eggxelent friend."
Togepi smiled and closed her eyes with Flygon.
Then a finger snap.
Flygon and Togepi opened their eyes and around them they saw a lot of pokemon look shocked as they saw them.
"RUN! RUN! RUN!" They were all yelling.
"Togepi and Flygon have 15 seconds to reach the finish flag or they're automatically eliminated!" PumpKingKing hosted holding a microphone.
"GO! RUN! MOVE! YOU'LL DIE!!" Many contestants started screaming.
Flygon and Togepi looked scared and began running, Flygon was slow but then Togepi began doing cartwheels and started going significantly faster like a car wheel, she crossed the finish line, which had been super far away in the wild area.
Flygon was running as fast as she could since she couldn't fly but... she ran out of time.
"Times Up!" Mew smiled.
"Wait what no please wait!!!" Togepi screamed.
"Thank you Togepi, for teaching me to loosen up a bit more and stop being so tense... at first I didnt like you cause you were so random and unpredictable, but logic needs some chaos to work well too. Thanks for opening my eyes and being my friend." Flygon started crying as she smiled and then was shot by the finger gun of PumpKingKing.
Flygon was being electrocuted, and burned alive, Flygon screamed in pain and after a few seconds, she was dead.
Togepi fell down to the floor and started crying seeing her friend die.
The players felt awkward.
"Welp let's go to the plane to vote off people!" Mew smiled as she teleported everyone away.
(Cargo Hold)
"Boss, we are in a really bad spot! Killing Foe just made everyone hate us more and it didn't even give you Immunity, it just gave you one heart back!" Makuhita frowned.
J4N-R had 1.5 HP.
"I need you two.. to vote me off.." J4N-R spoke.
"What?!" Asked OOM and Makuhita.
"I need you to vote for me, trust me." J4N-R spoke.
OOM and Makuhita looked nervous but nodded.
Now a bit farther away...
Lucah was crying, Kangaskhan, Gardevoir and Magby were trying to help her.
Togepi was sad in a corner, the players had never seen the usually always happy Togepi so sad.
"Um Togepi we're sorry for your loss..." Druddigon frowned.
"It's ok..." She still looked at the floor.
"Do you um... want us to vote you off so you dont have a chance of dying?" Asked Alcreamie.
"... No, I'll stay for Munchlax, Chandelure and Flygon... just vote a villain out I dont care.." Togepi hid inside her shell.
The good guys frowned, looked at eachother and nodded.
Lucah (Team Z): "i... i... I didn't even get to say goodbye to Foe... it all happened so fast... I can't believe... he really... is gone..." She started crying in the confessional.
Druddigon (Team Z): "Look I like many others weren't happy because Togepi was not happy, but we had to take down the villains, since Wigglytuff still has her Rare Candy, I rather take down someone without that." He crossed his arms.
(Elimination Room)
The room felt tense as many pokemon glanced around eachother thinking who they should vote out.
"Welcome to elimination, where one of you will be thrown out of more than 1,000 feet off this plane with no parachute as you take The Fall of Pain!" Mew opened the door and it was revealed the plane was flying high in the sky and it was night time.
"I hope Janitor leaves and feels pain, although he is a droid so I bet he wouldn't feel anything!" Lucah glared.
"Quiet you useless biological imbecile, all of you flesh meatbags are weak and useless, I would destroy you all just like that dumbass stoner with my bear hands, if you lowered your guards enough." J4N-R glared.
Everyone else glared back, other than Makuhita and OOM who were confused thinking why would J4N-R make himself so much of a target.
"Now you all have 1 vote, spread them around or target one person, you choose, Yamper you're up first." Mew smiled as the small yellow corgi walked to the pink porta potty to cast his vote.
After they all voted...
"The Votes are In! Let's see here..." Mew was reading the piece of paper.
Dramatic Music
"So everyone safe is... Dusclops, Numel, Vespiqueen, Sylveon, Flareon, Joltik, Handy, Krookodile, OOM, Gardevoir, Magby, Lucah, Yamper, Wooloo, Crack-A-Chu, Psyduck, Eva, Stonjourner, Kangaskhan, Druddigon, Wigglytuff, Totodile, Makuhita, Solrock, Alcreamie, Pincurchin, Mothim, Vespiqueen, Seismethtoad, Ludicolo, Togepi and Eiscue." Mew gave them all diamond berries.
Everyone looked to the left, and saw J4N-R had no berries.
"It seems J4N-R is eliminated, everyone voted for him a total of 32 votes!" Mew smiled.
"Ha! Get out of here you murderer!" Lucah glared.
"However you Australian, I will not be leaving tonight." J4N-R stood up and holded something in his hands.
"A Rare Candy, I have won immunity." J4N-R spoke.
Gasps!
"Psh, like you could ever eat that thin-" Wigglytuff was talking and then cutted off when J4N-R began eating the Rare Candy with a robotic mouth in his face.
"I made some improvements to my body in case this would happen." J4N-R glared.
Everyone looked horrified.
"J4N-R is safe for 3 nights counting this one and can choose TWO players he would like to send home." Pumpkingking spoke.
The players looked nervous.
"So, who would you nominate?" Asked Mew.
"I nominate Eva, Krookodile and Totodile." J4N-R spoke.
"WHAT?!" Krookodile looked nervous.
"Why me?!" Eva looked scared.
"GUA GUA GUA GUA GUA!!!" Totodile was panicking.
"Tell me, why should either of you biological flesh fleshbags stay in the game?" J4N-R asked.
"GUAGUAGUAGUAGUAGUAGUA!!!!" Totodile looked horrified and she rapidly shook her arms.
"I promise, I'll loyally serve and do anything you want!" Krookodile looked scared.
"Come on big boy, if you let me stay... I can show you you a good fuck feels like.." Eva the Salazzle grinned.
"I eliminate Eva and Totodile." J4N-R decided.
"What! You can't eliminate me yet, i- AHHHHHH!!!!" Eva the Salazzle was thrown off the plane
"GUAGUAGUAGUAGUAGUAGUA!!!!!!" Totodile looked angry as she was being picked up by Pumpkingking with her arms crossed, then Pumpkingking threw Totodile out of the plane, she gave a decending GUAAAAAAAAA all the way down.
"Totodile! No!" Togepi looked sad seeing her friend leave.
"Why... why did you choose them and not bigger threat like us!" Druddigon wanted an answer, he was angry cause he was pretty good friends with Totodile.
"And how did you get that Rare Candy!?" Psyduck asked.
"Simple. I've calculated the chances of me winning the tournament and it was 98.7% After.i had won, I was awarded a Rare Candy in secret, using this knowledge I decided to make everyone target me so my sole vote counted more. I eliminated Eva and Totodile because they had the most lives, I don't have to worry about you for 2 days, and all of your life's are already low enough which means... you will.be eliminated soon either way." J4N-R spoke coldly.
"Oh... so he decided decided get rid of the players with most life because they would survive the game longer, meanwhile us with low lifes are still in danger since we cant eliminate J4N-R for two episodes... while we have low lives and could be eliminated at any moment, gasp what a dramatic twist!" Eiscue fake fainted.
"Hopefully this challenge teached you something, no matter how many high life's you have-" PumpKingKings pointed at TV who showed a dead Scorbunny, and both Eva and Totodile screaming as they were falling down.
"-doenst mean you are safe, those three had high lifes and they are all gone now, and villains, don't get too confident and cocky, or you might as well end up like Dark Musharna or Hatterene, dead and none of them even saw it coming." Pumpkingking giggled.
The players either glared or looked scared.
"Alright, go back to the cargo hold everyone, more hard challenges will be incoming." Mew smiled as she teleported away with PumpKingKing, and the elimination doors closed.
The Final 29 out of 69 went into the cargo hold. However J4N-R went to Fancy First Class.
Krookodile (Team Z): "Ugh, I was almost eliminated today... heh well J4N-R better watch his back, just cause I said I would do everything he says doesn't mean I will, so yea I'll play with his robotic sensors a bit and trick him that I am following him, and then when all of his days are over, bam! Bye bye droid and hello Wish prize for me!" He pointed at himself.
(Cockpit)
"Ah that was a good episode, did we catch everyone?" Asked Mew.
"Yep, while hey were busy fighting Eternatus I catched these three Legendary Galorian Birds and two random Legendary Doggos!" Pumpkingking smiled.
"Nice! It means we are closer to catching them all." Mew grinned.
"yee, this is very exciting right?" Asked Pumpkingking.
"sure is, so that was another exciting episode, what will happen next? who will live and who will die? and most importantly who shall win the final wish?! Find out next time on Mew's Newest All-Stars Legendary World Tour!" Mew cheered.
Pumpkingking just smiled, it was all going according to plan.
The plane flew towards the moon.
Finally! This took such a long time to write, it's way harder than it looks, specially writting songs, God those take so long...
Episode Review: Gave us more insight on Foe, J4N-R and Magby, I wonder what other characters will get to shine soon?
Fun Fact: Totodile had her common candy, but she didn't use it because she was smart enough to know she would be targeted However Totodile wanted to leave the game for a while because of how deadly it was, so she gave her common candy to one of her friends before leaving, who is it? you guess!
Song Reviews:
Galor With Valor: It was pretty good ig
Stadium Audeathtorium Remix: It was nice, the sword and shield gym leader music in it was nice.
A Dimension Just for Me: Psh it's a parody, so no go bro
Next Episode! We shall go into the Sinnoh Region! We will have fun and smile as we do the beauty contest, dress up and dance! Now will the contestants impress the judges enough to gain immunity, or will they play their last performance...
~Thanks for Reading!~
~Liz~
